GenePrediction:GLEAN_7854 Details

Name: GLEAN_7854
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2587753..2585223 (- strand)
Length: 2531
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2587753..2587669 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_113:2587611..2586960 (- strand)
Length: 652
Type: CDS
Source: GLEAN
Position: GCSC_113:2586899..2586354 (- strand)
Length: 546
Type: CDS
Source: GLEAN
Position: GCSC_113:2586276..2585223 (- strand)
Length: 1054
>GLEAN_7854 class=GenePrediction position=GCSC_113:2587753..2585223 (- strand)
ATGGAGATGCTTCCGGAGCCGGCGTTGAGCGCCGGCCATGTCAGCCGGACGACATACGGCGGCAACCGGGCCTTCCACAA
CTTTGGTGGGTGACGGGTGAAGGGGAGCGGACGCGCCGCGAAGTGCTAACCAGCCCGGCCAGCGAACGACTACTCGCACA
TTTCGGACCCCAACCTGCGGCGGCGCCTGGCGCTGTCCGAGATCGACAAGGTGCCGTTTGGGCTATACCGTACGTTCTCG
GTCTTTGCCTTGATGTTCTTGCTCTTGTTTTCTGTCTCCCAGGCGTCACCTACTCCGCTGACAGCCCCAGACGTGCGCGC
CGTCGCCGTCGCCGGCGTCGGCTTCTTCCTCGACTCGTACGACATCTTTGCCATCAGCATGGTGACCAGTCTGCTGGGCA
TCGTCTTCTGGGGCGCAGCGGCCGAGCCGGCAGCAGCAGCCGAGGTGGCGGCGGCGTACGGCTACCGCGGCGGCGGCGGC
CAGCTGCCGGACAGCGTCAACCAGGCGCTCAAGGCGTCGACCAGCGCCGGCATCATCCTCGGTCAGCTCGTCTTCGGCTG
GCTGGCCGACGTGTCGGGACGGCGACGGATGTACGGCATCGAGCTGGCCATCATCGTGCTGTCGACGCTCAACTGCGCGC
TGGCCAGCCCGAGCCCGTCCATCAGCTCGACCGGCCTGCTGGTGTTCTGGCGCGTCCTGATGGGCATCGGCATCGGCGGC
GACTATCCGCTGTCGTCCGTGATCACGGCCGAATTTGCGCCCACGCGCTGGAGAGGCGCTATGGTGGCAGCTGTGTACGT
ACGTCGGGGCGCTCCTTCCGTTTTCCGCCTGTCCTCTTCTCCCTAACTCTTCAGCTTCTCAATGCAAGGGTTCGGCAATT
TGCTCAGCGCCATCGTCGCCCTCATCGTTACCGAGGCCTTCCGTTCCGAGTTTATCGTCGCCGCCAGTGCCGGCAGCTGC
GAAGGAAGCTGCCGCGTCGCAGCAGACCGGTCGTGGCGCATCATCATTGGCTTCGGCGCGCTACCGGCCTGCTTCGCCCT
CTACTACCGCATCACGATCCCGGAGACGCCCCGATACACGTTTGACGTCGCGCACGACATTGAAAAGGCCGATGCCGACA
TCCGCGCCTACATGGCCAGCAGGCCGGAGGGCGTGGTCGATCCGGTCGTGCAGGCGCGGCTCAAAAGCGTGGCTGGACCG
TCCATGTCAGTCCCGACGGCTTCCTGGACCGATGCCACGTGCTATTTTGGCCGTTGGAAGAATCTCCAGACGCTGCTGGG
CACCACGCTGTCGTGGTTCTTCCTCGACCTGGCCTACTACGGCCTGGCCCTCAACAACGCGGTCATCCTCGAAGCGATCG
GGTACTCGAGCGGGCAGACCCTCTACCACGTGCTGCGAAAGTGAGTCTTTACGTCCTCGGGATTTGTCTTTGTCTTCGTC
CTCGAGACGGCACCAGGCCTGCTACTCACACGCCCAGCAATGCCATCGGGACCATCATCCTCGCCTGTGCTGGCAGCTTG
CCGGGCTACTGGGCGGCCGTGCTCACGATCGACACCGTCGGACGCAAGCCGCTGCAGGTGCTGGGCTTCTTCATCCTGAC
CATCCTCTTCTGCGTGCTCGGTTTTGCCTTCCACCGGCTGAGCGAGGCGTCCATGCTGACCCTCTACATCGTCGCCCAGT
TCTTCTTCAACTGGGGGCCCAACACGACCACCTTTGTCGTCCCCGGCGAGTGCTTCCCTACGCGTTATCGCTCTACCGGC
CACGGCATCTCGGCCGCCATGGGCAAGCTGGGCGCCATCCTGGCCCAGCTCATCAGCATCCCCATTCTCAGCAGGGACTC
GCCGCCCCATTGCAGCACCGGCTCCATCGCCTGCTCGCCCTGGCTCAACCGCCTGATGCAGCTCTTTGCCCTCTTCATGC
TGTGTGGCACCGTCGTCTCGCTGCTCTTCGTGCCCGAGACTAAGGGCGTCACTCTCGAGGAACTGGCCGGCGAACCCCCT
ACCTCATACAATGCCGGCAGCAACGGCAGTGTCGTCGGCGTTCCCTCTTCCACTACCGGCCGCTTCAGCTGTCTCAAGTG
GAATCCTTTCGCCGGCGGCCAGCCTGCCGGCTTCCACTATCCACGAATGGATGATCTCAGAAATGGCATTGGCCGCCAGC
GCAGTCGTTTCCACCTCCGCCATCGCTACCGTCGCAACAATGGCAGCGCCTACGATGAGGACCGGGAAGATGTGCCGCGC
ATCGGGATCATGACCAGCCCCGAGATCGTTGCCCGGGATGCCGCTGCCCGTCGTGGCAGCCGCTGGCGAGCACTCAGCAC
CCGAACCTCGTCCACGGTGCAGAGCTGCCACATGGGAAGCGGCAGTGGTGGGCTACCGTCCTCTCCAACGCTGCAACCAC
TGTCGGTACCGGCAGCCACAGCGGCCGTCTTTCCTGGCTGGGGCGCAGGCTGGGGGCGTATTGACCGAGGTGGACATGCC
ACTACGCTGGACGAGATCCGGCTTCAGGACGTCGGCAGCCTGCTGAGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62