GenePrediction:GLEAN_7855 Details

Name: GLEAN_7855
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2577061..2570694 (- strand)
Length: 6368
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2577061..2571868 (- strand)
Length: 5194
Type: CDS
Source: GLEAN
Position: GCSC_113:2571796..2570694 (- strand)
Length: 1103
>GLEAN_7855 class=GenePrediction position=GCSC_113:2577061..2570694 (- strand)
ATGTACGGCACTGGCACCGGCCCGCATACGGGCGTTTCGACCCCACGAACATCTTCTTCACTCCGCCCTCTCACAATCTC
CCATGGCTCGCTCGAGACATCGTTCCTGATCCCGACCAGCCTACATTTCCATGCTTCCCGACTCAAGGAGGCATTCGCTG
TCACTTTACCAGCGCCCACCGACGAGCTTGCCCAGGATGACGAGCCGTCCTCCATCCCAGAGCTTGTTGCTCGGTACATG
GGCTTTATCGCACACGAGGTCGAACAGGGCGAGGACGATGCCCAAGGATCGTACGAGGAAGTTCTTAAGCTCATCCTGAA
CGATTTCGAGCGCGTGTTCCTGCGGGGAAACGAGGTGCACGTCATTGCTGCGGGCCTTCCTGGCATTGACGCCAAGAAAC
TGGTGCTTCTCCGTAGCTACTACGCTGCCCGCCTCGTCTCCAACCGCACGATCCGGCCTCATGTATCTGCACTGTTCCGC
GCCGCAGATGATGGCTCCGCGAACCTGTACAGCATTTTCGGCGGCCAGGGCAACATTGAGGAGTACTTTGAGGAGCTGCG
CGAGCTGTTTGAGACATATCCTGCATTTGTCGGCGACTTGATCTCCAATTCGGCCGAGCTGCTTCAGAACCTGTCGAAGC
ACCCGAACGCTGAGAAGCTCTACTCCAAGGGCTTGGATGTCATGACATGGCTCCGCCACCCGGAGACGACCCCGGATGTT
GACTATCTTGTGTCTGCTCCTGTTAGCTTCCCTCTGATCGGCCTCGTCCAGTTGGCCCACTACGAGGTGACTTGCAAAGT
GCTCGGTACACACCCTGGTCTATTGCGCGAGCGGATACAGGGCACTACCGGCCACTCGCAGGGCATCGTTCTTGCTGCTA
TCACCGCTGCAGCCGATTCTTGGGAGTCGTATGCCGAGCTCGCCAAGTCGGCTCTCTCTATTCTCTTCTGGATCGGCGCC
CGCAGCCAGCAGACGTTCCCTCGGACATCTATCACGCCCTCTATGCTCCAGGACTCCATTGACAATGGCGAGGGCATTCC
CACTCCCATGCTGAGCATCCGGGATCTCTCGCAGGGCGAGGTTCAGAAGCACATTGACGCCACGAACCAGTACCTGCCGG
CCGACCGTCACATTGCCGTCTCGCTTGTGAACAGCCCGCGGAACCTTGTTGTGACCGGTCCCCCTATTTCTCTCTACGGT
CTCAACCTGCAGCTCCGTAAAGTCAAGGCACCGACTGGACTGGAGCAGACCCGCATCCCGTACACGGAGCGCAAAGTGCG
CTTTGTGAACCGCTTCTTGCCAATCACGGCCCCTTTCCACAGCCAGTACCTGGAGAAGGCCACGACCTTGATCAACGAGG
ATCTTGCTGGCATTCAGATTGATTCTAAGACTCTTGGAACGGCCGTTTTCGACACGAACACGGGCAAGGACATGCGGCGG
TCTGTTCGCGGGAACATCGTGCCGACGTTGGTGCGTCTGATCACCCGCGATCCTGTCTACTGGGAGCTGGCTACCGCATT
TCCCGAGGCTACCCACGTTCTAGACTTCGGCCCTGGCGGCATTTCTGGCTTGGGTATACTCACTAGCCGCAACAAAGAGG
GTACTGGCGTTCGCGTAATCTTGGCTGGTTCTGTGACCGGAACTGTGTCTGAGGTTGGCTACAAGCCCGAGCTATTCGAC
CGTGATGAGGAAAATGCGGTGAAATACGCCATTGACTGGGTGCGGGAATATGGCCCGAAGCTGGTCAAGACAAAGAGCGG
CAAGACCTATGTCGACACGAAGATGAGCCGACTTCTCGGCCTCCCGCCCGTCATGGTTGCCGGCATGACCCCCACGACAG
TCGCGTGGGATTTTGTGGCGGCAGCGATGAACGCTGGCTACCACATCGAGCTGGGCGGCGGCGGATACTACAGCGCCAAG
ACCATGACCGAGAATCTCCTGAAAATCGAAGGTGCTATCAAAGCGGGACGCGGTATTTCCATCAACCTGATCTACGTCAA
TCCACATGCCATGGCATGGCAAATTCCTCTTATTGGCCGTCTTCGTGCTGAGGGTGTACCTATTGAGGGTCTCACCATTG
GTGCTGGTGTTCCTTCTATCGAGGTTGCGCAGGAGTACATCGAGACCCTCGGCCTGAAGCACATTGCCTTCAAGCCTGGT
TCCATGGACGCGATCCAGTCTGTCATCAACATTGCCAAGGCGAACCCGAAGTTCCCTGTCATCCTGCAGTGGACTGGTGG
TCGTGGCGGTGGCCACCACTCGTTTGAGGACTTCCACCAGCCGATCCTCCAGATGTACAGCCGCATTCGTCGGTCGGACA
ACATCATCCTCGTTGCCGGCAGCGGCTTCGGCGGTACTGAGGACACGTACCCTTACATCACCGGTGCATGGTCAAAGAAG
TACGGCTACCCGCCTATGCCTTTTGACGGCTGCTTGTTTGGCAGCCGCATGATGGTGTCGAAGGAAGCTCACACTAGCAA
GAACGCGAAGAAGGCCATTGTTGATGCTGAGGGTCTCGACGACAGCGAGTGGGAGAAGACGTACAAGGGCGCAGCTGGTG
GTGTCATCACTGTTCGTTCCGAGATGGGCGAGCCCATCCACAAGCTGGCGACGCGTGGTGTCCGCTTCTGGGCAGAGATG
GACCAGAAGATCTTCACCCTGCCGAAAGAGAAGCGCATCGTGGAGCTGAAGAAAAACCGCGATTATATCATCAAGAAGCT
AAACGACGACTTCCAGAAGGTGTGGTTCGGCCGCAACAAGGCGGGCGAGACGGTCGACCTCGAGGACATGACTTACGGCG
AGGTAGTGCGGCGCATGGTCGAGCTGCTCTACGTCAAGCACGAGAAGCGCTGGATCGACCCGTCGTTCGAGACGCTCACG
GGCGACTTCATCCACCGCGTGGAGGAACGCTTCACGGCGACGTCAAACCAGCTGTCTCGTCTGCAGAGTTACTCCGATCT
TGACGAGCCGTACTCTGCCATCGAGGACATTCTCTCTCACTACCCCGAGGCAGAGAACCAGATCATCAACGCCCAGGATG
TGCAGCACTTCCTGCTTCTGTGCCAGCGACGCGGCCAGAAGCCGGTCACGTTTGTACCGGCGCTCGATGAGAACTTTGAG
TTCTTTTTCAAAAAGGATTCGCTCTGGCAGTCCGAAGACCTGGAGGCCGTCATTGGCCAGGACGTTGGACGGACCTGCAT
TCTGCAGGGCCCTGCGGCCGTCAGGTACTCCAAGGTTGTGGATGAGCCGATTCAGGATATTCTTGATGGCATCCATGAAG
GCCACATTGCTGGGCTGACCAAAGATGTGTACAACGGCGACGTCTCTGCAATCCCGACCATTGAATACTTTGGCGGCAAG
TGGACGGAGTCGGATGTGCCTGTGGATTTGGAGAGTGTTTCCGAATCGTACGACGAGCACAAGAACATCTACCGGATTGC
CTACGCAGCCAATGTGTCACTCCCGCCTGTGGACGAGTGGTTGTCTCTCATCGCTGGTAAGAGCCACTCTTGGCGACACG
CGCTCCTGCTCTCGGACGTGCTGGTCCAGGGCAAGAAGTACCAGACGAACCCGATAAAGCGTGTGTTCGCACCGGTTCGC
GGCCTGTTTGTGGAGATTCGGTACCCCAACGAACCGGACAAGACCGAGATCATTGTGAAGGAGCAGCCGAGACAGAACCA
CTATGTCGATGTGGTCCACGTGAAGCTGTCAGCCGAGAACGAGATTGTGGTGAACGTGATCAAGCAGACGTCTGCTCTTG
GCAAGCCGGTCAACCTGCCGCTCAAGTTCAGGTACCGGCCCGAGGCTGGGTATGCCCCGATCCACGAGGTCATGGAGGAT
CGCAACGAGCGGATCAAGAAGTTCTACTGGCGCGTGTGGTTCGGTGACGAGCCGATCGATCTGAACGCAGACGTGCGAGG
CAAGTTTGACGGCGGCAAGGCGATGATTGCAGGAGAGGACATCAACGACTTTGTGCACGCCGTGGGCAACACGGGCGAGG
CGTTCGTGGACCGTGAGGGCAAGGAGATGTTCGCGCCGATGGACTTTGCCATTGTCGTTGGATGGAAGGCCATCACGAAG
CCCATCTTCCCGCAGACGATTGACGGCGACCTGCTCAAGCTTGTGCATCTGTCGAACGAATTCAGAATGCTGCCTGGCGC
CGATCCGCTGAAGAAGGGTGACGAGGTGTCGACGACGGCACGGGTCAATGCGGTCATCAACCAGGAGTCGGGCAAGATGG
TGGAGGTTTGCGGGACAATCGAGCGCGAGGGCAAGGCGGTGATGGAGGTAACGTCGCAGTTCCTGTACCGGGGTGAGTAC
ACGGACTTTGAGAACACGTTCCAGCGCAAGATTGAGAAGCCGGTGCAGATCCACCTCGCGACGAGCAAGGAGGTGGCGGT
GCTGCGGTCGAAACAGTGGTTCGTGCTGAACGACCAGCATGACATCCCGCTGCTGGGACAGACGCTCACGTTCCGGCTGG
AGTCGCTGATGAAGTTCAAGAACAAGACGGTCTTCAGCAGCGTGGAGACGCGGGGCCAGGTGCTGCTGGAGCTGCCGACA
AAGGAGGTGGTGCAGGTGGCCAGCGTGGAATACGAGGCTGGCGTCTCAAACGGCAACCCGGTGATCGACTACCTCGAGCG
CAACGGGTCGGCGATCGAGCAGCCGATCAACTTTGAGAACCCGATCCCGCTGAGCGGCAAGTCACCTCTGGTGCTGCGGG
CGCCGGCGTCGAACGAGACGTATGCGCGGGTGTCGGGCGACTACAACCCGATCCACGTGTCGCGGGTGTTTGCCAACTAT
GCCAACCTTCCGGGCACGATCACACACGGGATGTACTCGAGCGCGGCGGTGCGCAGCCTGGTCGAGACGTGGGCGGCGGA
GAACGACATTGGCCGTGTCCGCAGCTTCCACGCGTCGCTGGTGGGCATGGTGCTGCCCAACGACGACATCAATGTGAAGC
TGCAGCACGTCGGCATGATCAGCGGCCGCAAGATCGTCAAGGTGGAGGCGGTCAACAAGGAGACGGAGGAGAAGGTGCTT
CTGGGCGAGGCCGAGATCGAGCAGCCGGTGACGGCGTACGTCTTTACCGGTCAGGGCTCACAGGAGCAGGGCATGGGCAT
GGATCTCTATGACAGCAGCCCTGTGGCCAAGGATGTCTGGGACCGTGCGGACAAGTATTTGATGGAGACATATGGTGAGT
TGGCGTGTTTTGCGCTTATCCTTGCATTTTTACCTTTTCACTTCACCCTCTTCTAACACATCCAGGCTTCGCAATCACAA
ACATTGTCAAGAACAACCCGAAGGAGCTCACGATCCACTTTGGTGGGCCGCGCGGCAAGCAGATCCGGCAGAACTACATG
ACCATGACGTTTGAGACGGTCATGGCGGACGGGTCGATCAAGTCGGAGCGGATCTTCAAGGACATCAACGAGACGACGCT
GTCGTACACGTACCGGTCGCCGACGGGCCTGCTCTCGGCCACGCAGTTCACGCAGCCGGCACTGACACTGATGGAGAAGG
CCAGCTTCGAGGACATGAAGGCTAAGGGCCTGGTTCCACGCGACAGCACGTTTGCCGGTCACTCGTTGGGCGAGTACTCG
GCGCTGGCGGCGCTGGCGGACGTGATGCCGATCGAGTCGCTGGTGTCAGTGGTGTTCTACCGCGGCCTGACGATGCAGGT
GGCCGTGGAGCGTGATGCCAGCGGACGGTCGAACTACTCCATGTGCGCGGTCAACCCGAGCCGGATCTCGAAGACGTTCA
ACGAGGAGGCGCTGCGGTTTGTGGTCAACAGCATCGCGGAAGAGACCAAGTGGCTGCTCGAGATTGTCAACTTCAACATT
GCCAACATGCAGTACGTGTGTGCCGGAGATCTGCGGGCTCTGGACACGCTGGCGGGCGTGACGAACTTCCTCAAGGTGCA
GAAGATCGACATCGACCAGATGAAGGCGCAGCTCAAGCTGGAGGAGGTGCGCGAGCATCTCAACGAGATCATCCGGGGTT
GTGCGCAGGAGACGGAGAAGAAGCCGAAGCCGCTGGAGCTGGAGCGCGGCTTTGCGACAATTCCTCTGCGCGGCATCGAC
GTGCCCTTCCACTCGACCTTCTTGCGCAGCGGCGTGAAGCCGTTCCGGTCGTTCCTGTTGAAGAAGATCAACAAGACTAC
GATTGACCCGGCCAAGCTGATCGGAAAGTACATTCCGAACGTGACGGCGCGGCCGTTTGAGCTGACAAAGGAGTACTTTG
AGGACGTGTACCGGCTGACAAACTCGCCGCGGATTGGACACGTGCTGGCGAACTGGGATAAGTACCAGGACGACGGGGTG
GCCAACGGGGTGAGCGGGACGCAGTCAGAGGAGTTGTCGGAGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62