GenePrediction:GLEAN_7857 Details

Name: GLEAN_7857
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2557174..2555630 (- strand)
Length: 1545
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2557174..2557078 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_113:2556409..2555940 (- strand)
Length: 470
Type: CDS
Source: GLEAN
Position: GCSC_113:2555879..2555831 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_113:2555760..2555630 (- strand)
Length: 131
>GLEAN_7857 class=GenePrediction position=GCSC_113:2557174..2555630 (- strand)
ATGGCTTCCCAAGAACACGACGATGAAATCCACGAGCAGACGCCGGGCTACAAGCTGTCGCAGCCCAAGCAGAGCATCGC
CGAATACCAGCAGATGGGTACGTCAGTGTGACTGGGCGGCATCGTCGTGTCTGGCTTGTTGCTTGCCCGCGATCGTTGCA
TAAATGTGTCGGTGAAAGATAGACGAGAGACGGAAATGGCAGCAGCAGCAGCAGCAGCAGTGGTGGCAGCAATAGCAGCT
ACAATGACGGCAGGAGCCAGAACCGGCTGGCCGACGGCTGTGACACCTTCCTTGGCCATCCATTCACTTTCCGTCCGAGC
CTCTTCTCAGTTCTCCTTCACGTTTGCCTTACATTTGCCTCACCCTGCCACCCACAACCCACCCAACTGTTCGTGCTGTC
GCCTGAGCACAGTTGCTTGTCTTTTGACCACGTCCTTCCTCCGATCCGCCACACACTTCCCATCCTCTGTCCTGCCTTTC
TCTGCTTTTTTCAGCTGAGCTTCTCATTCTCCCGATCCGCTGCTTTCTGCTTGCCCACGATGAGTGTCTCTGGCGTCTGT
GACAGCTCCGTCTCGGTCTCTGTTCCTGCACCGCCCCCACCCTCACCAAGACGCGAGTTTTACTCGCAGTCAAATGTCCC
TGTCACGGCCTTTGATCTGGACGAGCTTTTCCGTCTCCTTCGCTGCAAAGCCGACACTGCTTCTGCTGCTGCTGTCTCTC
CTCGAAGCACTACTCCTCTCACAATCACCACACCCACACACACAGCCAGTGACCACTTGGTCCTGCATCTCATTGGATCA
GATTTGCTGACTTTGGAGGGCAATGGCGGGGACGGCCTAGGCCGAGCTGAGGCAGCCCTGCCCAGCTCGGACCCCAGCCC
CAACCCTGGCCACCGCCTGGGCACCAATACAGATGCTGGCGATGAATCTCTCCAGCGGTACAAGCTTTCGCTCGGTCTCG
GCGGCGGCACAGACCTCAGCGACCCCAATGATCCCCGCGTCGCCATCATCAAGAGCCTGACGATGGAGTCTCCCGGCCGC
GACCCAGTCACGATCGACCTCAGCGTCCCCGGCACCGAGACCACGCTGAAGGACCACCCGTTCACGATCAAGGAGGGTGC
TCTCTTCACCATGGTGGCTACATTCAAGGTGCAGCACGAGGTGCTGAGTGGCCTGCGCTATGTCCAGATCGTCAAGCGGA
AGGGCATCAAAGTCAGCAAGGACAGCGAGATGATTGTATGGCAGATCTCCTTCCTGGTAATACGTTGACGCGGTCGTGAC
TGACACTCCACACAGGGAAGCTATGCTCCCAACACTGACAAGCAGCCCCTCTACACAAAGAGATGTAAGTTGTCTGCCCC
CCTTTTCCACACACAAACCACGTCGCTTCGTAGCTGACGACCACTGCTTTCTAGTCCAAGAGGACGAGGCACCCACCGGT
ATGCTCGCCCGCGGCCACTACAGCGCCTTTTCCAGCTTCGTGGACGACGACAAGAAGTCACATCTGGAGTTTGAGTGGAG
CTTCGACATCACCAAGGATTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62