GenePrediction:GLEAN_7858 Details

Name: GLEAN_7858
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2551465..2550462 (- strand)
Length: 1004
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2551465..2550818 (- strand)
Length: 648
Type: CDS
Source: GLEAN
Position: GCSC_113:2550766..2550748 (- strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_113:2550694..2550563 (- strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_113:2550502..2550462 (- strand)
Length: 41
>GLEAN_7858 class=GenePrediction position=GCSC_113:2551465..2550462 (- strand)
ATGGTTCTCGCAGCTCATCCAAACCCGGACGCTCCTGTCCTCACCCAGTTCTCCCTCGCTGGCAAGACCGCTCTTGTCAC
CGGTGGAAGTCGCGGCATTGGCCTCGAGGTGGCCAAGGGCCTGGCCGAGGCTGGTGCCATTGTCGCCATCACCTACTCGA
CCAGTGAGCCGCAAGCGGCCATCGCCGCAATCCAGACGGCTGCAGCTGCCGCATCCTCATCTTCGGCGTCCGTCACGCCT
CGCGCCTACAAGTGCGACGTCACCGAGCAGGCTGCTATCGAGGCCGCCGTCGAGGCAGCCGCTCGGGAACTCGGCACCGG
TCGCCTTGACATCCTCGTTGCCAATGCCGGCATCAGCGACCACACAACCGCCATCTCCTATCCCGTAGATGCCATGCGCC
GCATATTCGATGTCAACGTCAATGGTGCCTTCTGGGCCGCCCAGGCCTCTGCTCGCGTCTTCCAGCGCCAGGTTGCCGCC
GGTGGCCGTCCCGGCACCATCATCTTCACTGCCTCCGTCAGCGCCTCGATTACCAACACCCCCCAGCCTCAGGCCGCTTA
CAACGCCACCAAAGCCGCTCTCGTTCATCTGGCTAAGGGTGTTGCCGTTGAATGGGTAGACTTTGCTCGCGTAAACTGCG
TGTCGCCGGTGAGTTTTCCTTCCCGTGTCCATCCTATATAGTCCGACTAACAACCACAGGGATATATTGAAACAGACAGT
ACGCTACTCACCCGTCTATAAAGGCACCTGATCTTTCAACTAACAAAACAGTGATCGCTACGGTTCGGGAGGACTGGCGC
AAGGAGTGGATCCGCCAGATTCCTGGGCGCCGGATGTGCCAGACTGCTGAGCTCAAGGGTATCTACCTTTTCCTGGCCAG
CGATGCCAGCAGCTACATGACTGGTGAGCCTCTTCACTCATGCGTTTCTGTGTTCTAGTTGCTATGCTGACAAGTACTTG
TAGGAGCTGATCTAATCATCGATGGCGGCATCAGCTTGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62