GenePrediction:GLEAN_7859 Details

Name: GLEAN_7859
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2547232..2542654 (- strand)
Length: 4579
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2547232..2547194 (- strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_113:2547150..2546894 (- strand)
Length: 257
Type: CDS
Source: GLEAN
Position: GCSC_113:2546826..2546505 (- strand)
Length: 322
Type: CDS
Source: GLEAN
Position: GCSC_113:2546454..2544747 (- strand)
Length: 1708
Type: CDS
Source: GLEAN
Position: GCSC_113:2544500..2544317 (- strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_113:2543269..2542654 (- strand)
Length: 616
>GLEAN_7859 class=GenePrediction position=GCSC_113:2547232..2542654 (- strand)
ATGTACCCGGACGGACACATAGCACGTGACGTGAATCACGTGAGTGAAACTAGCTGAAAGCGGGCAGTCGTTTTGCGCAA
AGCTGCTTCTGCGCTGGCTTTTACGGAGCGCGGCAGCGGAAAAACTGCCGTTTCCATTCCTGGGCATTTCTCACCCGCGC
ATTCTCACGCGCGCCCGACCGGACAGCAAAGGCGTCGCCGCTCTGACCTCTGCGCCCGGCCGCACTCGCTGCACCTTTTG
CCGGATTCCGTCGTCCTTGGCCACCATTCAATCTGCTTCTGAGCAGTGTCGCTGGATTGCGCGCCCAGACGCGATTCCGT
CGGCCCATCTTCGTCACGCGTGTGCTGTTCTCTTGTCGGCGAAAGTGCGAAAAACGGCCTCTCTCTGGCATACGTCTGCC
ACACAGGAAGCCGTCTGCGAGCGAGGCGCCCGAAGACGGTCCGGCTGCATGCATTGGCAGGAGACGCCGGCGGCGGTTCT
CTTTCGACCCTGTCAACGCGCGGAGAAGACCAGACCGCCTCCGCTCCACCAAGAACTCGAGGTTCCATCTGCCGGTTGGC
CGACGCTTCTCGGACCAGGTCATCGGTAGCAACTCCTGCGGTCTCTGCGCCCGTCGAGCACCAGACCAGCTGGCACCCGG
CTCTCATGGACGAGCCCCGGTGCTACAATTGCGGCATGTCCGGCCACCAGACCGTTGCTTGTCCAGAACCCACGCGTGTA
GTACCAGCGTGAGTATCTCCTGCATCTTTGCACCTTTGCACCTTACATCTTCACTCAGCCCAGCGTGCTGACCACGCTTA
GCGGCCTCGAGGAACACCGGAAGCGACAGGCCACGTCAAAGGGCCTCCGCCACAAGAGCCGAGGAAAACACTACGCGTCT
TCGTCCGCGTCATCCCTCAGTCGACATCCCAACGGCATGGTCGTCACACGATATCCGCCCCCCCCCTCTGTGGGCGAGCC
CCAGATCACCCGCTATCCACCCCATCACCAGCTGTCACATCTGCCGCCTCCACCGCCCATGTCTCTGCTCCCTCCTCCTC
CGCCCTCGGCCAATGGAGGCTCCTACCACGGCTACCACCCCCAGCATCACGCCCTTCCTCCTCATCCTCCACCTCGTCAC
CAGCCAGGGCCGGAACCATGGAAATATCCTCCCCAACAGCCGGCATATCCTGGGCCTCATTCGTCGGTACCGGCGCCTCC
ACACTATCCTCATTACGACACATTTGGCCAGTCGATGCCAGGTCCGTCGCCACACGCTCCACGCTCGAGGTCTGCTCCAG
ATTCTTCCTACTACAGCCAGTCGTATCCTCCCCAGCCAGGGTACTTCGCGTCTCCTCCATCCGGTGTAAAAGGCCCCTCT
GTTATCCCACCGCCCCCGTCCTTTGCCTCGGCCCCCTATTACCCTCAGCCTCCACACCTGTCCCATCCTCTTCCCCAAGC
GCCTCATCACCAACCACCTTCAGGTCTGAGCCAGCCCGGTACTTCGGAGCCATACGCACATCACGAGTTCGGACGGCCGC
TACCACAGTCGTATCCCTTGTACGGCTCTCCTCCGTCCAACCTGCCCAATACTCCCAGATACCCACAAGGGAGTGGCAGT
GGCAACGGATGGCGTCCTGGGAAGCGTGGCGACTTCACCGGCCCATTCCACCGCGGCGGACGGGCCTCTTTTGGCAAAGA
CAGAGGCGGCCGCAGACATTACCCAGCCAACGCCAACGGGTTCCGCCACAGCTCTTTGGAGCATTCTATTGGCGGCTCCT
CTATTCCAACTGGGCCTGCAGCTCTAAGCCGGCGATTTGCGGCAACTGCTCCCGATTCGGAACGGCGAGCTCCGAGCAAC
GATGCAGCGTCTGGAGCAGCTCCAAGTCAGCTCGCATCACCCGCTGTGCCTAATGGCATCCCTGCCAAACCGCCAACACC
GATATCGATGTCCCGATCGGGCTTGAAAAAGGGCGGCAGGCCACACGAAGCCGTGAAGAAGGCGGAGCTGGATCATACAT
CGAGCCAAAGCTCGCCCAACACGATCGCCGAGTCAGAAAGCCTAGATCCCCATCTCTCTTCCCAGAAGCGGACCAACGAC
AGCCATCTCACGGTTGACGATGACAGAGGGATCAAGCGGAACCGGCTATCGCCAACCGACTGGTCAGCACCAGGCCGACA
GAGTGTTACGCCCGTGTTGTCCGGAAAACCAATTGCACCGGTGTCAGACACGCCGACATCGTCACACGCCGACAGAAAGC
AGGACGAGGACGGCGCGCAGACACACGACTCTTCGCCATCCAAGAATAGCCTCCCCAATCCGCCCAATGGTTCACCCTGG
AGCAGCCGTCCTCCCAACCGTGTTTTGAGCTATGGCACATCGGACCACGAATCGAGCGGGACTAGCACCCGCCACGACTC
TGGCTACCACAGCAACGACGGAGCTCAGCCTGTGCTGGCGGCCACCAAGGGCAGCGCAGCTGTCTCGGGCCTTCTGGTTC
CGAGCAGTCTGCCTTCTTTACCGCCTGCCTCCAGACGGGAGAACAACAGCCGGAGCCGGAGCCATAGCCAGAGCCGGAGC
CACAGTTGCAGCCCAAGTCAAAGTCACAGCCACAGCCAGAGCAACACACGTAGTCACAACCAAAGTCACAGTCACAGTCG
CAGTCGCAGCCAGAGTGACAGTCACAGCCGGGGTCGCAGTCCTGCGCGCCACATGCCTCACAGCCCACGAGCAAAATCAC
GCTCACATCGAGGCCGCAGCGGCTTCTCCAGGAGCCGCAGCAGCTCACCCCTGGACGACCTGGAGCTGGCCATGCTCGGC
ATGGTTCGGCCGGAGAGCGACGAGGAGAACGAGGGTCTCCAGAAGCCGTCTGACAAGTCTGGCGGAAACCAGAAGATCAG
GAAGCGACAGCAGCCAAGGGTGGCCACTGCATACAGGTTTGTCTGCCCCGTCTCTTCTTCTTGCGTTTGTCTGGCTGGCT
AACAAGAGTGCGCCTCGGCCAGCCGCCGTTGGTAGGGCTATCGGGCCGGCGAACCGAATCGCTTGTAATTTCCACCTCTC
ATACTATTGGCGTTTCTGATTTTGGAACTGCATTTTTCACCCTCTAGCTCGTTGATCTCGGACGCATATACAAGCTACTG
CTTGCTGTCTTTTGCTTCAATTTTGTAGTCTCTGCCGTTACGCAGGGGTAAGTCGGCAGGTATTATCAGATGTACCGGAT
AATGAGCATTGCTTGCATAAGGCCATAAAACCTCTCGAGGTTGTCGGCGGCCGCTCTTGATTTTACAGGCATTGCAATTG
TCTAGGCGGTTATTTTTATTAGATACAAGGAGAGCCACTAAGCATATGGCTCTCTTATGCAAATATGTTTTATGCAATAT
AAGGCAGGCAGGCACTCTTCCCAGCACGTACGGCCATAGATACTGGAAAGCACGGGATCCCGTCCGCTCTCCCCTAGTTA
AACCAGTAATCGGCGGATTAGTAGTTGGGTCGGTGACGACCAGCGAATACCCGCTGCTGTACGTTTTTTTCTCTCTTTTT
GCCCCTTCCCATTATGGTCTGTTCTTCTCCTAGTCAAGCTCTGATATCTTGTTCGCAATGTTCAACTGCAAGGTGAACAA
CGACGCAGTTCAACGTTCAGCAAGACGCTTTGCTAGCTCCAAAAAGGAGCGACGCTAGAGATCGAGATGGTGATACATCC
ATCCATACGCCTTGATACATAGGAACACGCCGAACATATCTGCTGTTCAGGCTAGCTCTATCCTTTTGTTTACAGCCAGA
GTCCGTTCGGACTGGACGGATACTTAAAGACAGCTTTCTTTGCTGATCCGAGCAGCTTTTTGAAATCCCAGATCCAACAA
GAACAACAAACAACGCACAACAGCAACAAAGCACATCATCTTTCTCGCTCCTCCCTAAACGCCAATCAGCACACCAAGTA
GCAATTCAATCTCTGTTGCTATTCCACTTCTCTGCCTCAGCAGACCGTCCAAGACAACGCAGTACCTACACCCCTTTTTT
TCCACACATCTCCCCTTCAAGATCACTAACATTCTCGCTTTCACAATGGGTTCTAACCACTCCACCCAGTCATCCAAGAA
GCAGGGCTCACGGCACGGGTCGCGTAGTGCGACGAAGCAGTGGGAGCGCCAACAGGGAGAAGAGCGGCTGCAGCGAGCGC
TACGTGACGAGGGGGTTCGTGAGTTCATGGCAGGAGGCTGCAGTGCAGCAGACGGTGGTCACCGCCAACAGGCGCGTAGC
AGCAGCAGCAGCAGCAGAAACAATAAAAACAGCGGCCTCAGCCGCTCCGACGGCCTCTCACGGACGTCCAACGTCAAATA
CAAGACAGCGCCTAGGGCAGCGGAAGGCTCTCGGCGGGAACAACAGCTCGCCGAGCAGGCCTCGCGGGTGCAGAATGTCC
CGTCGGCGGCGTATTCGGGGGGGTCGCCGTCTCCGTCTGTTTGGGCATCTGGCCAGTATGGGACAACGCGGCCAGTGCCA
CCCTCATCCCAACAGCCTGCCTCGTCGGGCCCCAGATGCATGGTAGACCCATCCAAAAACCAAGGTGGGCGTGTCAGTCG
CTTCCGTGAGGAATTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62