GenePrediction:GLEAN_785 Details

Name: GLEAN_785
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2077611..2078306 (+ strand)
Length: 696
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2077611..2077652 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_97:2077719..2078306 (+ strand)
Length: 588
>GLEAN_785 class=GenePrediction position=GCSC_97:2077611..2078306 (+ strand)
ATGTCGTATTATGACATAGATGCCATTCTAACGGATGCAGAGGTATGGCACAATCTTTCTTGGCCCCACCTCCAGCGGTT
CTTGCTTCCAACTAAAGTGATCGGACAGAAAATACCATGCGAGTTTCAAATTGACGTCCCTGGCCTTGGTTACTTAGACC
AGACCCCATCACACTCCCTCCGAAGAGGCACCCGTCTTGGCCTCCCGCTGTGGCTTGCCGAAATGCTAGCTTTAGCCCAT
AGTGCATCTGACGACAATCCACCCTTCCTTACCCTCAATCTTCCACCTGCTCTGACCAACGACGTTGTCCAGGCTCTAAA
GGCCGACCCTCGTTCGGTCCCCCTCCGCGACCAGTCCGCCCATTTCTACAGCCTAGCTACACGCATACTCGACCTTTTCG
AAGAGCGAGACCTAGCCGTCGTCCTGCGCACTGCTTTTGTCGGACGATCCGCAGAGATCGGCTTGCACGCTCGCAAAGTC
GGGTATGGTTCAGCAGGCGGGGGTAGCGGGAGCGGCAGCAATACGTCGAACGGCGATAAGAAGGATGACACGAACAGTAG
CAACCTAGGAATTGGATCCACCGGGCAAGAGTTTCTTCGAGGCCTCGATGAGTGGGAGCGGCAGCTCTTCCGACACGCAC
ATGATGGGGCAAAGTCCGGGCGGGAATTTTTAGACAGTGTCAAGCGGAACTATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62