GenePrediction:GLEAN_7860 Details

Name: GLEAN_7860
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2541873..2540712 (- strand)
Length: 1162
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2541873..2541726 (- strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_113:2541472..2540943 (- strand)
Length: 530
Type: CDS
Source: GLEAN
Position: GCSC_113:2540768..2540712 (- strand)
Length: 57
>GLEAN_7860 class=GenePrediction position=GCSC_113:2541873..2540712 (- strand)
ATGTACGGTGGCACGAATGAAGAGTCCACAAAGCCGCTGCTCATCTGTCTACACGGTGGCCCCGGCATGTCGAATCGGCA
AGAGACATCTATCTATTCCATGTTTGAAACCCGCCTCCGCGTTCTCATCTACGATGCCCGTGGAAGCGGTGAATCCTCTT
AAAAAGGTCCCTACACACATGACCGCTGGATCGAGGACATTGAATTTCTAAGGTATCTTGCGGCAGGATCCTTAAGAATA
AAACAAGCGAGCATACCTATACGGACCGTGTGACCAGCAGCTGTCTTACACCTTCTATTTTGGGTTTTGGGCACATGCCG
ACAAGTTTTGTCTTGTCGGCGGCTCTTATGGCTCCTTCATCGCGATCGACTATGCACTGGCCCATGGAGACCGCCTTATA
GGACTAATCCTCAACAGCGCTTGGGCCGACGGTGTTGCTGGTGCCATGGGCGCGCTAGCTAATGTGATAAGATGGGAAGT
AACGGCAACCTCTGTCAACTTATTACAAGGGTGTCACAGGCCTATAGCCATCAAGCAAATCGAGACCATCAGGGTAGACG
TCGATCGCCAGAAGCGAGTGTGGTCGGGCACGTTACTGGATGATGGCGACTTTTTAGACGCTGTCGTAGAGCTGCTACTT
GTCACTGCAGCCGCAAACCCCAGAACGTCTATGGACACCAACTATTGCGAAGGCGTGCAGCTTCAGGAAAATGACTCTCT
AGCAGCAGAAGCGCTTGACAAATTTTCTCGCGGCCAGGGCAACACGGAAGTCGTCTCAGAGACAGAGACTGGGGCAAATG
TACGGATATACGATGATAGTTGGAAGCTTTTGGGGCTTATTCACCCGCAAACCTTCGCTGCTACACAGAACACAGCCTTT
CACGATAATATGCCGCGATTCCAAGTGCTCGACAGGCTGTGTGAGGTTCAGGTACGCATCGAATCTTTTGTACTTGACCT
TTCTAATACAGGTAATACTAGACATCAACTCTAGTTGTTGCCGGGGACCATGATTTATTCACACCACTTGCTGGCAACAA
GGAGATTGCCAAACGCATCCCTAATGCGAAGATCGAAATTTTTCGCAATTTTGGCCACCTTCCAGGGCCCCTTTTACATG
CCCTACCAGGGCAAGAGGACAAATTCGGCCGTGTACTGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62