GenePrediction:GLEAN_7865 Details

Name: GLEAN_7865
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2515931..2515491 (- strand)
Length: 441
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2515931..2515884 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_113:2515759..2515635 (- strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_113:2515536..2515491 (- strand)
Length: 46
>GLEAN_7865 class=GenePrediction position=GCSC_113:2515931..2515491 (- strand)
ATGGTCGCCTACTACTCCATCCTCGGTCGCCAGGTCGGCTCCCACTATGTCAGTAGCATTTCGTCCGGCAGCCATTCCGT
TGTGTCCCGCGATCGGCCAGACGGCCGGGACATATTGTCGGCCCTGCGCCGTCGCCAATTGTATGCAGAGTGCTAACGTG
CCGTCGCTGCAGCTGGCCATTGCCACCCTCTCGACCCTCTTCGGTGGTGTCTACATCGCATCGTCCGGCCCCAGCAAGAA
GGTTGCTCAGCTGCCGCCCATCAACGCCGGTTCTCCGGACGAGGCGGATTTTGTCAAGTGCGTCCATACATGCCCAATGC
GGCGCATGCCGTCTGGATCTTCCCCCCCATCTTGCAGCCCTTGGTGTGGAGCATTCAGCTGACAGTTGATCGCAGGAAGT
TCATCGAGGAGGCCGACGGCAAGAAGAAGGAGGCACACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62