GenePrediction:GLEAN_7867 Details

Name: GLEAN_7867
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2510623..2508674 (- strand)
Length: 1950
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2510623..2510393 (- strand)
Length: 231
Type: CDS
Source: GLEAN
Position: GCSC_113:2510320..2508674 (- strand)
Length: 1647
>GLEAN_7867 class=GenePrediction position=GCSC_113:2510623..2508674 (- strand)
ATGGGATCTACCGGCGAAGACCAGGCGGCCACCTTCGATTACATCATCGCCGGTGGAGGAACTGCTGGTGTTGTGGTGGC
CGCTCGCCTGAGTGAAGACCCTAGCATAAAAGTCCTGCTCATCGAAGCCGGAGCAGACCACAGCAAAGATCCCCTGGTCC
TCACACCGGGTCTAGTTGCCGGGGTATACGGCAAGAAGGAGTACGACTGGAACTTTTCTTCTGTGCCCCAGGTATGTTGT
CGATAGCGGGAGAGAGGGATGAAAATGATTTCTCTGCGAATACTGATGCAATGACTGCTGTAGCCCACCCTCCATGGCCG
GGCTATCAACCAGGCACGTGGCCGCATGCTAGGTGGCTGTTCTGGGATCAACTTTATGATGGCCGTGTATCCTAGTCGCG
CCATCCTCGACGCATGGGGTGCCCTGGGCAACAAAGGATGGTCCTTTGACGAGCTGGAGCCTTACTTCCGCAAATTTGCC
ACCACGGAGCCGCCATCGGCCTTGACGACCTCGACCTGCCGTGTCGCCGGCCACTACGATGATGCCATCACACAGACCGA
GACTGGCCCGCTGCAGATCTCGTACGGCGAGGGACACAGTCCCAACAATTCGGCCTGGTTCGACACCTTTGCCAACCTGG
GCTTGCGCATGACGTCCGACCCTCGAGGCGGAAGTGCTGTCGGTGCCTTCCAGAACACTGCCACCATCGATCCCAAGACC
AAGACGCGCAGCTTTGCTGTCACTGCATACCTGACCGAGAAGGTGCTTGCACGCACGAACCTTACGATCTGGACCGAGGC
CGTGGTGACAAAGATCTTGCTGGAGTCACCATCCGCCCACACGGCAGACCCAGATGTCGTCGCGGTGGCCAAGGGTGTTC
GTGTTCGCTCGGGCAACGGTGGCGAGACCGGCAAGGAGCGAGACGTCTTTGCGCGTGCCGAGGTGATCCTGGCTGCGGGC
ACTCTACAAACCCCACAGCTGCTCGAGCTTTCGGGCATCGGCGGCCGCGACATTCTCGAAAAGCATGCCATCCCCGTCGT
TGTCGACAACCCTAACGTCGGCGAGCATCTGCAGGACCACGCGGTCGTCTGCCAGAGCTTTGAGGTTGCTCCTGGAACTC
TGTCTGGTGACATCTTGCGCGATCCAGACCTTCTTAACGCCTTAGTCCAGCAGTACCAGACCGACGGCCAGGGCCCAATG
GGACAGAGCGCCATCAGCTGTGCCTACGCACCTCTCCTCGACGCTGACGGCCCGCTCTCGGCCGAGGCACGCCAGGCGTT
TTTTGACGCCCACAGTGACAGTGGTGAGGAGGAACATGGCTTGGTGCGGAAGCTTCTGTCTGGTCCCGGCGAGCCGTCGG
TGCAGTTTCTGCTCTTCCCAACGCAAGTCTCCATCCGAAAGAACCCGTCGTCGATGGCAGAGATTATCGTTCCGTCCCAG
CCTGAGAACTACCTCACTATCATGAGTGTGCTCAACCATCCGTTCTCGCGTGGCCAAGTCCACATAACATCTGGAAATAT
CGACGACCTTCCGGTGTGGGACCCTCACTACAATTCCGAGAGCATTGACATGGAGATCCTTGCACGAGCTGTGCGCTTTG
TCGAGACCTTTGCCTACACTAAGCCCTTTGCTGGCCTTCTGATGCCCCCCGGAGAGGGAAAGCGGATGCCAGATATATGT
GCAGATGATCTGGACCAGGCACGCGAAATTGTTCGCCAGGCGCAAATATCCATATTCCACGTCTGTGGCAGCTGTGTTAT
GAAGCCAAAGGACAAAGGCGGTGTTGTCGACGGCAAACTGCGCGTCTATGGGGTGTCAAACCTCCGTATTGTCGACGCCA
GCATCTTCCCCATCGAGCCACTTGGCAACATCCAGACGACCGTCTATGCCGTGGCCGAAAAGGCAGCTGATATCATAAAG
CAGGGCCGTCAGGGGCACTCCAGCAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62