GenePrediction:GLEAN_7868 Details

Name: GLEAN_7868
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2506589..2505083 (- strand)
Length: 1507
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2506589..2506539 (- strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_113:2506333..2505540 (- strand)
Length: 794
Type: CDS
Source: GLEAN
Position: GCSC_113:2505484..2505282 (- strand)
Length: 203
Type: CDS
Source: GLEAN
Position: GCSC_113:2505213..2505083 (- strand)
Length: 131
>GLEAN_7868 class=GenePrediction position=GCSC_113:2506589..2505083 (- strand)
ATGGCGTCGTCAACGATCAACGCCATAAAGGTCGAAAAAACACCGATCCAGGTGCGCTTTATACTGCCAACAGTTCGCCC
TATATCTGACGATACGTCCAGGAACTCAAGCTTACACCAGATACAGATTGTGGACCGTCGGCCGGGGGCCTGGCAACCCC
CATTGTGTGTTTGACAAACTCAGCCTGAGGACAACATGGCCTTTTTATACCGCTGAGCAGGCTGGCTAACGAAGATGCCT
CTGGTGCTGTGTTGAGCGAAGACGTCTGTCCGAAGCGCGGCAAGCTCCGCCCTCTGCGGGCATTTCGCTAGTCCAGTACC
ACGCCGACTTTGGCAGCGTAGTGGGTAACGATCCGGACTACGCGCTTCTTCTCTCGTCGGCCGAGTCATCGCACAACCCC
TTTTTCCACGGAGGATGCGCACACGTTTTCGAGGCGGCCACAGCGGCACTAACGGCGCCATCGGTGGCAGCATCGCCGGA
CGAGGTGCTGTACGTCACGTCCAACATGCTGCAGACCACGAGCAGCTCGCAGCTGCCGGTCATCCTGATATCCCGCGTGG
CCATCCGGCGCAGCGACGATGGTGACATCACGGCTGTCGAGTGGACCAAGCTCCGACCGCCATCGACGATGCCGATGCCG
GCAGGCGCCATTCCATACTCGGCGAGCCAGGCGGACGGCATCCTCTACTGCGCTCAGGGCAGTCCCAATCCCGGCACAAG
TGGGCTCTTCTTCATGCCGCGAGGCCGGCCGCCTCAGGCGCTGGTCACGAGCTACTACGGTCACGACTTCAACTCGGTGC
ACGATGTGGCCTGCGCGCCCGACGGCTCCCTCTGGTTCACGGACCCGTGCCACGGCTTCGAGAGGGAGTTCCGTAAGACG
CCACAGCTGCCGTGCCACGTGTATCGGTTCGACCCGGCGTCAGGCGAGCTGCGCGTCGTTGCCGACAGCCTGCAGCGGCC
GACGGGCATCTGCATCAGTCCTGACGCTAGTACGGTCTACGTCACGGACACGGACTCCCTGCACGCCGACGGCAAGCAGA
ACCCAACTCGGTACGTATCCTTCACGAGCACTGGCGACTCTTCTCTCTGCTGACCGCTCTGATAGTGCTGCGACAATCTA
TGCCTTTGACGTGATACGCCGGGGGTCGTCGGACTTTCTGGCCAATAGACGTGTCTTTGCGTATGCTCTGCATGGGGTGC
CGATTGGCGTCAGATGCGACCCGGCTGGCAACGTGTATGCCGGATGTGCAGACGGGGTGGAGGTGTGGAATGCCGGCGGG
TCGCTTCTGGGCGTGATCGAGGTTCCAGGTAAGCTGTGGCGAAGACCAGATGCTAAAGTGTCTGGGATGCGCATGCTAAC
TTGAACGTTGGTTCAGGCGGTGTCAGCAGCTTCTGCATTTCCACGGAAGGCGAGATGTTTCTTTGCTCAGAACAGCAGCT
ATGGTGGCTGCATGTGAAGAAGAGGCCAGAAAGATCCCGCGGAGAAGCTCTCGATTTGATGACGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62