GenePrediction:GLEAN_7871 Details

Name: GLEAN_7871
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2490453..2488388 (- strand)
Length: 2066
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2490453..2490353 (- strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_113:2490272..2490137 (- strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_113:2490073..2488388 (- strand)
Length: 1686
>GLEAN_7871 class=GenePrediction position=GCSC_113:2490453..2488388 (- strand)
ATGTTCCTAAAGCAGTTGGATCTCACGACGGCGCTCCGGCCCTCCTATCTGCCAGATGAGGACCTGCTTTTTGTCCAGGA
CAATGTGGGCCTGTACGAAGGGTGAGCTGCGGACTTGTCTGCCCGCCTTCTGTTCGATTGCGCGCGGGAGAGAGGCAGAG
CTGACGGCGCGGTGCGGCCAGGAAATACAAGCTACTCAACCAGCAGAAGGGACAGGTGTATCTGACCTCACACCGCGTGT
GCTATGTCGACAAGGCAGACCCGCGAAAATATTCGGTGTCGGTGGACCTGAAGGAGGTGGAGCGCTATGAGTTTTATGTG
TGTTTGTAGGCCGAGCAGTGTCGCGATCCGATTCGTTGGTAGGACGCTGACGGGACACAGGCCGGATTTCTCAAGTCGTC
GGCTAAGATCACGCTGGTGCCGAAGCCGAGCAGACGGTCAGCGCTGCATACGCGGCTCAACGGCGGCAGCAGCAGTCCGT
CTCGCGGCAGCAATGGGCCGCAGCAGCAGCGAGTCGAACGGGATCCGACGCCGATGGCGGTGGCAACGTGGGTGTGCACG
ATCTGCAGCTTCTCGAACCCGCTGCCGTCCAACTTCGACCCGGAGGCGCTGAACGCACAGACGCCACTGCCACCGTGTCT
CGCGTGCGGGATCCAGCCGACGCTGACACACGTACTCAAAGCGGTGATTGCCAGCGCGTCAAACCGGCCGCAGCTGCCAG
TGCGTTCAGCAGCCGACGACAGTGAATCTTGGGATGACGTGCTGGCACCGGAGCCGACCAAGGCTGACAGCGGCGACCCA
GCCTTTCCGTGTCCGCGGTGCACCTTTCTCAACTATCCATCGCTGCTGTCGTGCGAGATGTGCGGGGCGGCACTGGTGTC
GGAGGGGCTGCCGGCCGAGCTGACGCAGCTGCAGCTGTTCCGCGAGGAGTCGCCGGGCCCGTCTGTGGCGGCCAGCTTCT
CGACGCAGCCGGGAGCCGACAGCGCGCAGAGCGTCAAGCTGTCGTTCCGGGGCGGTGGCGAGAAGCTGTTCTACGAGCGG
CTCAAGGGGGCGATGGCCCAGCGCAAGTGGCTGCTGCACAACGCGCCACCGGTGCCGAGCCGAAGCCAGGGCATCGTGGG
TGGTGACGGGTTGACGTTGCTGCAGACAGGCAGCGAGCAGCGAGCGCGAGCCAAGGCGGCCGGCATCGCCGGGCTAGAGA
AGCGGGGGCTAGACATGCGCAAGAACACGGAGCTGGTGATCGGCAGCGCGTTTGAGGACTTGGAGGCGCTGATGGCGTCG
GCGAAGCAGGTGGTGGCGCTGGCGGAAACGCTGGCGCGACAGTCATCATCGGGATCGTCATCGGGGACGGGAACGGCAGC
CATGGCGGATGCCAACAGCGTGCTGGCCGAGTCAGCGAGCCAGCTCGGCCTGGTGACGACCAAGGACATTGTGGGCGGTG
GCGGCAGTGCGCGGGAGTCGCTGTACCTGTCAGAGCTGTCGCGCAACCTGGCTGAGTTCTTGACGGACGACGCGCGAGCG
GTCCTGCGACGAGCAGGTGGGATCCTCACGCTGGTGGACCTGTGGGCCGTGTTCAACCGGGCGCGCGGCGGCGTGGAGCT
GGTCAGCCCGATGGACCTGCTGAAGGCGGCACAGCAATGGGAGAAGCTGCGGTTGCCAGTGCGTTTGCGCACATTCCGGA
GCGGCGTGATGGTGGTGCAGAGCCGCGATCGGACAGACGAGGCGACAGTGAAGGCCTTGGTCGGCTGGCTGCGCGATCTG
CGGGACCAGAGGGAGCAGGAGGACCAGACGGACCAGACGACAACATCATGGTACTGGCAGGAGTTTGGACGCGGCGTCAA
CGCACAGGAGACGGCCCGGCAGTTCGGCTGGAGCATCGGCGTGGCCGAAGAAGAGCTCGCCATGGCTGAAGAGCGCGGCG
TCCTGTGTCGCGAAGAGGGCATCAGCGGGCTGCGCTTCTGGGAAAACTTTATCGACACGGGCGAGTACCGCAGCAAGCGG
AAGGCCAAGGCAAGGTCACATGACGAGGCGGTGCAGAGAGCACTGCGCGATGCAGGCCTGATATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62