GenePrediction:GLEAN_7874 Details

Name: GLEAN_7874
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2472386..2471819 (- strand)
Length: 568
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2472386..2472253 (- strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_113:2472197..2472093 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_113:2472014..2471819 (- strand)
Length: 196
>GLEAN_7874 class=GenePrediction position=GCSC_113:2472386..2471819 (- strand)
ATGTCCGCCATACGTACCCTCCAGCGCGCACTGCCCCGGTCACGCCCGGCCATGTCGGCACCTATCATGATGACGAATCG
GCCCCGCCTATTTCATGCGACAGCCTCTGCCCAGGCGATCCACGAGCTGAAGAGGTGCGCGCCGTGCCCCGGTTGACGTT
CCCATCCCCCTTCGACTGACAGCTCCCAGCAAATCCGACTTTGATGCGGCCGTCAAGCAGCACAAGACAATCATCATCGA
CGCCTTCGCTGAGTGGTGCGGTCCCTGCCATATGATCTCGCCCATCTATGCAAAGTGAGTTATTCAACAGAGCGCCTGGC
CGCAATCTCTTCAAGCGTGCGGCGCAGCTCTAACCAGATGTGCCAATGGCAGGCTCTCTGACGCGTACCCCTCAATCCGG
TTCTACAAGTTCGATGTCGACCATGTGCAGGATCTCAGCGCAGCACTGGAGATCCGGGCGATGCCGACTTTCTCCATCTT
CCAGGACGGGAAACGGTTGGAGCAGGTGGTCGGGGCAAACCCGCAGGCTCTGAAGGTGGTGCTCGACCGTCTTTCGAAGG
AAGATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62