GenePrediction:GLEAN_7875 Details

Name: GLEAN_7875
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2470629..2464885 (- strand)
Length: 5745
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2470629..2468565 (- strand)
Length: 2065
Type: CDS
Source: GLEAN
Position: GCSC_113:2468510..2464885 (- strand)
Length: 3626
>GLEAN_7875 class=GenePrediction position=GCSC_113:2470629..2464885 (- strand)
ATGGCTTCAAAGGCTCAGGCCGCTGGCAACCGCAGGAGGCGGCTTGCTGCTCTCGCGGACGAGTGGCAGGTCGGGCTTCT
GCCGCCACCGGCTCCCATAGTGCGGCCACTGCAACCGCTGAGCGTGCGCATCCCCGCTGATGACCAGACTGCCGAGGAGC
TTCTAAAAGAGCAGAGGCTCGCAGCCACTGCGGACGGCCAGCAGCAGCGCTCTACCAGTCTCTCCCGAACCTTTACCACC
TTGAAGAAACGAGACAAGGCGTGGGAGCCGCGGGAGATCTTCGTCGCCCTCGATGCCCACATCGACAAGCAAGGATCGCC
TGGAGTGGCTGAGGCTCTCATCGCCAAGCTCGTGACGGCCGGCGGCGATATCAACGTTGCCAGCACGAAGACCAAGACAA
GCTTGTTGACCCGTCGCCGGAGCGTCGAGTCGTTTGAGCGCGGCCGTCTTCTGCAGCGGGCCATTGAGCACGGCGACTCT
CGACTGGTGGCCATCCTCGTGCCCTACGCAGATTCGGTCACCCTGGACGGCAGCCTGCCGGGTGCCATTCTGTCCTGCCA
TGTTGCCGTTGTGGAGCACCTGGTGCGCTATGGGGCCAGCGCCTCGGCTACCTCTGCCGGCCGAGACGCCTTTCGTAAAG
TCTGCTCTGCCGGCGGCCAAGAGGACATCATCAGCGTCCTGCTCGCTTCTGGTGGCTGCCCTCTGCCCGACATTTTGTCG
CCTGCCCTGGTTGACGCTGTCGAGTGCGGCTGTACTGAAACTGTTCGGCACCTCAGCCGCGCTTCTGCTGACGGCAGCTT
CGAAAATGCTTCGGCCCTATTGAAGGCCATTGCTGCCTCTCGCGTCGATCTTGCGCTGGCCATCTTGACCGGCTCGAAGC
CTCCCTCGGTACCGCTTCTCAACGAAGCCTTTTACGAGCTGTTCAGACAGGAAACCATGCATCCTAACGAGAAGATGGCC
ATGGCTGAATCACTTCTGTGCGCAGGAGCCTCTGGCGACGCTGTTGCTTCCGCCGTGGACCAAGCTTGTCTCAGCAACTT
TTCTAAGATGGTGTCTCTGCTCATATCGTACGGCGCTCCCATTGAGCACGAGAACGCCATCACGGTTCGCCGAGCCATCT
CGCAAAAGCAAATCGACCTTGCCCGCATCTTGCTTGCTAGCAACACGACACTGCGCCCGCAATACGCCTCCGAATGTGTG
GCGCTTATCCCTAAACATGTTTCTAACGAAGAGCGCCGAGAAGTTCTGGAGTTGCTTCTGCGCAAAGGTGCTAGCGGGAT
CCCGCTGCATGACTGTCTCATCGACGCTGTCGAGGCTGGCGATATCAGCTCGACACAGCTGCTTCTGACGCCACACTTTT
CTGGACCAGAACGCCAGGTAGTTTCGAGCCCGTCCCCAAATCCGTTTGTGGGCAGGAAGAGTCTTCAGCGCCATCACACG
GCCTCTGCCGAACATAAGGAGGGCATGGCGCTACAGCTGGCTGTACAGACCATGAACTTCTCCATTGTCGACCAGATCTT
GGCCGTACGGCCAGCGCCCGAGATCTTGGCCAATGTTTTCCCCAGCATCTCACTTCTGTCTCCGGAGCCGCAGTACCAAA
TGTACGAGCTCTTCTTGGCCACTGGATTTTCTGGACCGTGTGTCAGTGCTGTTCTGCAGCGCGCGCTTGAGGAACGGCCA
TCGAACAGGGACTCGCGCCTCATTGCCCTTCTCCTCAGGCACATTGGCGATACCAGTCAGGCTGGCGGTGCCGGTGTCCT
TGCCGCCGTCACCAACCACGACATAAGCCTTCTCAATACCATTCTTCAAAATAGCCAGCCGACGGTGCAGACTGTTGCTG
CCGCCATGCCGCAAGCCATGGCCATTGACGATCTTCCGACAAGGCGCCTGATGGTGCGCTCACTCCTGATTGCCGGTGCG
GGACAGGATGGAAAATCGGTTGCCGAGGCACTGGTTACAACATTGAGCGCAAACCCCGTCGACGGCGAGCTTCTCCACTT
GCTGCTGGATGTCGGACTGGCCGATGTTAATTACAACGCCCAAGCAGGATCGCCGGTGACTCTTGGTAAGAACGTTTCTG
GGCCCCAGTCTTCGATAATGACCTGACAAATTATCCCAGCTGCCATCAACCCAGACCCGAGAGTTTTGGATGCCCTGCTC
AAGACACAACGATCAAACCGGGACAATCTCGTCCATGCTTTGTATGCGATCTCGAATCTGCCGTTCACTGACGCTAAGGC
TGTCAAACTGAACATGCTGCTACAGCACACACAAGATGAGGCTGCCCTGAGCTATTTGCTGGTAGCTGAAGTTGAGGCTG
CCGTCAAAAATCCGCCTGATCCGCGCATTCTCTCTGTGATCAAAACACTCTTGGCTGCCGGTGCCGACATAAATGCGCGC
AATGCCGCAGCTCTCTGCCATGCCGTGACGGCGTCAAATGTACGTATCGTCGAAATGTTTCTCGTTCGGCGGCCGAGCCC
GGATTCTCTGGCCACTGCCATCTCACGCATATTCTCCATCCCTGACGCCATGGACCGGCTTTCGCTGGCGAAAGTGCTCT
TGGAAGCCGGTGTGCCTGCCCACCAGGCAAGCTGTGAGCTGAAGCATGCCGTGGTTAATACCCCCGACGATATTCCCCTT
CTCAGAATGTTAGCAGAGTTCTCAGACCCTGAGCATTCCGGCGCTCTGCTGGTAGCGGTGCAGCAACAAAAAATGGAAAC
TGTGAGCATGTTGCTCTCATCGCAGAAATTTGCCGTGCCTGTCCTCAACAGTGCTCTGGTTGAGACAATGCGTGTGGCGG
ATAAAGGAAATCGCCAGGTCATTTGCAACATGCTGGTGAAGGCTGGTGCTACCGGAACGGCCGTGTCTGATTCGCTGCTA
TCTGCCGCACAAGATGCGGACCTTGACCTTTGCCATATCCTGCTGGCCAACGGTGCTAAAATTGGCCACCAAGACGGACA
GGCTATTGTATTGGCGTGCCGATCTGGCGCCGTGGGCACGGTTGAAATGCTTCTGCAAAGCCTCCCCCCGACACCGGACA
AGGACGTGGTACTCGTGCGCGCTTTCCATGAGGCCGGATTGTTGGACGATCTAGCCATGAGAGAGACACTGTTTCGGTTG
CTTCTAGAACACGGCCTCCGTGGTGACGAGCTTGACAAACAGCTTGTTTCAGCAGTGAGCCATGGCGACGATGGAATTCC
GCTCATTCGGTTACTGCTGGAATATGGTGCGAGCCCAAACTACAGTAGCGGCGAAGCTGTCTGGACCAGCACACGCAACA
GCTTCCTACCTACGCTGGAGCTTCTTCTTGGTCTCGAAGACCATGCTTTCATGAAGGAAGAGGATGCCAGTACGGTGGTT
GTAGAAACGACAGCTGGAGAAAACGGCCCAAAACCGTCACAGGAAACCATGGTCAGGGCGTTAAAGGCAAGCTGGATGCT
GAAGGGGGAGGATCGATATCAGGTCATAAAGTCTCTGTTTGCGGCCGGCTTGAAAGCTGGCGAGGCAGTCCATGTCGCCC
TCAAAAAGGCTGTGAGAGATTCTAAACCAAACCTTGACCTCGTTAGTCTGCTGCTCTCGAACGGGGCATCTCCACTGGAA
GGCGGTTGCCAGACTCTGGTCGATGCAACATGGCGATGTCTGGTGCCAATTTTGGAACTGTGCTTAGCACGGGAGATCCC
CAGTGAAGATCTCAACTACATTTTCGCGGAAGCCTTTGCGCCGAGCGACACGTCAAGGTGGCTATCAGACGATGGGGTAT
CCGTTGCGAGGCTCCTCTTGGAAAAGGGATCTAGAGGCGATGGGTTGCCGAGGGCTCTTATTGCCGCCATACGTAACTGT
GGAACTGACAAGGATCACAATTCCCGACAACTCATTCAGCTCCTCGTCAAGCATGGCGTCGACGTGAACTTCGAGCATGG
ACAGCCACTTCAGGACGCGGCGAAGCACGGAAGCCAGGAAATCGTCCGACTTCTGCTCTCGCTCAACCCAGATCCATACT
CTGCAATCGCAGCCTTTCAACTCATTCTTGAATCAGGGCCGGCTGAAGAGGATGTCATTGGCTTAATCACACTTTTCAAC
GATTATAGGATATCGGGCGATGCGTGCGGGCCAGAAATCATATTCAACCATTCAGACTTTGAGCCGGTGGTCTTCCGGGC
GATGTCACAGTACCCTCGATCAGTCGGAGTTCTGGATGCCCTACTGAATTCTGGGTATTACCACGATCAGATGACAACAG
CGCGTGTAGTGCCGGAGATAGAAGAAAATGAGCCCGTGTCGCTGTTGTTCTGGGCGTTATTGCAGCCTCAAAAGAAGATC
AGCAGTGCCGTGGTCGAGCTTCTCATCCAACGGGGATCAAAGGTCAACTTCGAGACGAGCCGGTCGAGGATGACACCGCT
GATGCTCGCTATTCAGAACAAGCGGCAGGACCTCGTCGAGACACTGATAACGGCTGGCGCAAACATTGACATTGCGGACT
ATGCTGGCAATACGCCCCTCTTCATGGCCGTGTGCTCGGGGGGTGATGCTGGCCTGTCGATGGTAGAGTCTATTCTCGGG
GCTGAACCGTCCAGAAACGATGGGTCATTGCACATGGCGGCGCGTAACCTCAACGTCAAGGTGATGAAGTTGCTGGTGCA
GCACGGGCACGAGGTGGACTTCCCGAGCGATCTCCATGATGGGCGTAGCGCGTTAGCTGAGATCTGTCTGCATGGCTCCG
ACGGTCGGGTGCTGACGGCCAGCGCGCTGAGGGAAATGGAGTACGCAATCAGCTATCTGATCAAGGAGGGCAGCGATGTG
ACACTCCGGTCGGACGGCAAGACACCGCTGCTTCTGGCCCTAGAAGCCGAGGACCCGGTAGGCACGACACAGGTGCTGCT
CAAGGCCGGTATGCACAAATATGTCAACAAAGCGTTCAACCAGTACGACGACGGCACGCACATATACTCGCCGACGATGT
ACGTGAGCCATGTTCGCTACTTACAGCCTTCGACGCCGGCGGCAGAAACAGTTCGCGAGAAGCTGCTCGGACTGCTGAGA
AGGAGCCGAACCGAGGATGTATATTATGCACACAGTCCTGGTGGAAAGGCCCAGCCAAAAGGGGCAGTAGGCGTGCCGGA
GGAATTGCTACGAGCAGAACGCGAGCGGCAGGCACGAGAGGAGCGCGTGGCGGCCGAAGATCGCGATCACGAACGGGCGC
GACGACAAGCACAAGAGCTGGCTGAACTGGCTGAGCGGACACATAGGGAGAGCATGGCCAGAGAGCGGGCAGCGATCCTG
GAACGAGCACAGGCATATGCCGAGGCAGCACGGGTGCGGGAACTGGGCGAGGCGGCAGCGCATGCCGAAGCTGTGCGAAT
GCGAATTCGGGCGGAGACGGAGGTTAAGGCAGAGGCGCTGCAGTTGAAGTTGCTGCAACAGGAGGCCGAGCAGGTGGCAC
TCCTAGAGCAGAGCCGAACGGCACACGAGCAGCAGTTGCAGCTGGAGACCGATCGAAAGAATCAGCTGCTGATCCACGAA
AAAGAGCTCAACATGGAGCGAGTGAGCGCGGCAAAGCAGATCAGCGACATCACATTGGAAGAACGACGGGCGCTGGACCA
GCTGAACGAGGTGCAGAACCGACGGGAGAGGGCACGGTTGGAAGAGGGAAGACGGCTGGCGGATGCCATTCGAGAGATAC
CAGGCGCTAATGGGGCGATAGGGAGCCGCAATATGGCGGGATATATCATGGGCGAGGAAACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62