GenePrediction:GLEAN_7876 Details

Name: GLEAN_7876
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2464036..2462892 (- strand)
Length: 1145
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2464036..2463926 (- strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_113:2463863..2463699 (- strand)
Length: 165
Type: CDS
Source: GLEAN
Position: GCSC_113:2463632..2462892 (- strand)
Length: 741
>GLEAN_7876 class=GenePrediction position=GCSC_113:2464036..2462892 (- strand)
ATGCGGTCGACTGTGAGGGTATGGCCGCAATTGCAGGCAGCGTCACGGCGATGCTTCTCGTCGTCTCCTGCGCGGCTCGA
CAAATACGGTTTCATCGGGCTCGGTCAAATGGTGAGCAGCCATTTCTGCCGTCCTTGTATCAGAAACAGGGCAGCTTACA
CTGACACGCCCAGGGCTATCAAATGGCAAAGAACCTGCAGTCAAAGCTGGGGCCGTCAGATAGCGTGCGGCTGTTTGACA
TCAACAAGGAGGCCGTTGCCAAGCTGGCGGGCGAAGCGTCCGGCACAGGTGCCGCCGTGGAAGTGGTTGCAGACGTCGCT
GCTGCTGCGAACGATGCAGTGAGCATGTCAACTTGTGGACTGATCCGTGGACTCTGAGCATATGCCGAGGCTGACTCAGG
ATAGGATTACGTAATCACCGTTCTTCCAGAGCCGGCCCACGTCCGGGCTGTGTACAAGTCGGTGCTGGAGTCAACGTCGG
GGCCGGGCACGACGGTGTTTGTGGACTGCTCAACGATCGACCCGACGACATCGCGAGCGGTAGCTGCGGACGTAGTGGCG
GCAGGCCGGGGTGCCTTTGTGGACGCGCCCATGTCGGGCGGCGTGGTCGGGGCGACGGCGGGGACGCTGACATTTATGCT
GGGCAGCCCGGACGCGGCGGTGACTGAGCGGGTGCAGCCGGTTCTGCTGTACATGGGGGCGCGAGTGCTGGGCTGCGGTG
GGCAGGGCGCCGGGCTGGCGGCCAAGCTGGCCAACAACTATCTGCTGGCGATCAACAACATTGGCACGGCCGAGGCGATG
AACCTGGGCGTGCGCTGGGGTCTAGACGCGTCCGTGCTGGCGGGCGTGATCAACGCGAGCACGGGCCGGTGCTGGCCGAG
CGAGGTGAACAACCCGGTGGCCGGCGTGGTGGCGACGGCGCCAGCTGGCCGCGACTATGCCGGCGGCTTCGGGCTCGCGC
TGATGAAGAAGGACCTGACGCTGGCGATGACGGCGGCCGAGGAGGCAGGTGCACGGCTGGTGCTGGGTGAGGCCGCACGC
AGCCTGTACGAGGCCGCCGGCGAGGACGAGCGCTGCCGCGGGCGAGACTTTAGCGTTGTGTACCGGTATCTCGGCGGCGA
GGAGGGGAAAGAGGGAAGGGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62