GenePrediction:GLEAN_787 Details

Name: GLEAN_787
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2100491..2103170 (+ strand)
Length: 2680
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2100491..2100574 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_97:2100643..2100752 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_97:2100814..2101824 (+ strand)
Length: 1011
Type: CDS
Source: GLEAN
Position: GCSC_97:2101886..2101931 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_97:2102014..2102636 (+ strand)
Length: 623
Type: CDS
Source: GLEAN
Position: GCSC_97:2102699..2102851 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_97:2102918..2103170 (+ strand)
Length: 253
>GLEAN_787 class=GenePrediction position=GCSC_97:2100491..2103170 (+ strand)
ATGCAAGCCGTCTGGGGCTCAGAGACGCCGGGTATTGACGAGCACACGGCGCCAAAGCGCCAGCGGCTGTTCATTGCCCG
CCAGGTGAGCGAGCCCTGTATTGGCCGCCGACGCGTCTTTTTGGCGCCTTCTGGCTGCTGACACGGCAGAAGGCATGCGA
GAGCTGTCGCCAGAAGAAGACACGATGTGACGGCGGCAACCCGTGCGGGCTTTGCCGCTCTGCCGGAATCGAGTGCAGAT
TTGCCGAGCGCAAGGCTACGAAGTCAGCTCCAGACACCCCAATCCCGACTGTGCCCCTTGCTACATCTCCTGACGGTCTG
CAGAAATGAGGTTTCTCTTGGCATGATCTTCAACACGCTGCAGCGCATCGAGTCCAAGATAGAAACTCACCAAGAGCAGA
AGCAGCTGCAACAACAGCTCAAGCAAGGCCGCAATGGATCGGCAGCCATGCTTGTCGAGGGCGAGCTGCCCTCGGAGCTA
TCCCCTCGGCGGCCGAGCAGCACCGCAGCTACCGAGCTGGCATCGCCTCAAGCCAGCAGCAGCCTCTACAGCCCCCACTG
CCACGAAACACCATACCGCCACGCAAGTGGAATATACGAGCTGCTATCGGCGACGGGCACGCCCCCCGGACAAGTTTCTG
ATATCAACCACCACGATGGTAATAGCAGCATCTTGTCCCCCTCCTCCCTACCGCCGCCGCCCTTCCGCAGCCGGTCGCCC
CGACACGTCCCCGTCATCCAATACCCCATCCGCCAGCTGACGAGCTGGCCAGCCGTGCGCGTGCTGCTCGAGGAAGCTGC
AGCCAAGGCCGGTGACGACTTCACATATGACGCCGCTGTCGCAACCATGCTTGAGCAGCGCCGGCCCCCGCTACCGTTGC
CATCGCCGTCGCTGATGCTGCTGCAGTCGAACTGGCTAGCTCAAATTCACGTCTCCGTTGTCAAGGACCTCGGCGACAAG
TACTTTGCCACATTCAACCTGGGCAACCCCATCCTAGACCGCCGCCTGTTCAGTCAGCACAGTCTTGCCGTGGCCTTGCA
AACCGAGTTTGGTGTTAACATAGAGAGCTGTGTGGTGCTGGCGACGATGGCCCTAGGCGCTCTTGGGCGCAAGGCTCTTG
TACAGACAGGCCTCGACACGGTCACAGAAACGGCCGCGGCTGCAGCCATCACTACTAGCATAGTCCCACCGCCAGACGCC
ACGAGACCATTCGGCGAGGGTGGCTGGGATGTTTGGGAAGACGGCTTGGTCTTCTTCAACGAGGCCCGCAAACGCATCGG
GCTCCTGGGCTGCGATAACAGCCTCCAGGCATGCCAATACTACCTGTTGACAGGGTTGGTCTCCTCTCTCACTGCGGTGG
CCGGATAGCGGTGCAGCATCTGCTGACCTGCACAGGCTTTTCTACTCGCAGCTTTTGCGGCCCGTCGACTTTTGGGCCTC
GGTGAGCCGTGCAAGCGTCTGCTGCACTAGCTTCTGGGCATGGTGAGTCTTCTTGAATCCTAAGCCTCCCACGCGCATCC
TAGTGCAGCCATCCTGATGCCAGCGACAGCCTTCCCAAGGACTGCGACGACTGGACTATGGACATGCAGGCGCGCCTTTT
CTGGACATCTGCTATGTTCGAGGCTGTCCTGACCCAGGAGCTTGACCTGCCCGTGTCTAGCCTGCTCACATACGAGGACC
GTGTGCCGCTGCCGCGCTTTGTTGAGTTTCCCGGCGTTGCGTCCGTGGTATCTTCGCTCGTCGTCGCTGCCCCGCCGCTG
TCGGCGGCCACTGCTCGAGAGGCTGAGCAGGATTCTTTCTGCCACTATCACTTCCTGTCGCAGATCGCCCACCGCATCAT
CTTAACACGTCTGTGCGACAGCCTCTTCGCCAACCGCAGCCGCGCTCTGGCCAGCCGTGCCGCCGCGGATGGCGCAACCA
CCATGACGCGCAACGACTACCCACCACAGGCGCTCGAGGATGAGCTGCTGCACCAGCTTGAGCAATGGCGCAGTCAGCTG
CCGGACAATTTGAAGTGGCGCACCGATAGCGTCAACTTGGACGGGAGTGCGGATAGCTTGGCCCTCACACCAGCAGACGC
TTTGGTCGTGCCGTGGTTGCGGGCACGGTACTACATCGCGCGATACCATCTGCGGCGGCCACTGTTGTAAGTCATTGCAC
GCATGCATGGTGTCCTTCCTTGATTTTGGTTCTCCCCTAACCTGTTAGACACCGCGCCCTCCACCACCCCAACTGGATGA
CTAGGGACGACTTCGACAAGTGCCGCGACGCCATTGTATGCGCCGTCGATTGGCTGACAGTGATTCAGCCCGCCCTGTTG
GCCATGGATTGCCTGCATCTGAAGTTCTTTGTATGCACACAGTGAGTGGTGCCTCCACTTCTTTCGCTATGTCTGCGCTC
TGGCAACACATCGCTCACGCGCACTAGACTCTTCGGACAGCTCTTGTTGCTGCACGCCCTCGAATCCTCTTCCGTACCTG
AGCTGCCTCAGCTTGTTCCCACCAATTACGCAACGTGGCGTATGCTCGCATTTCGCTTTCTTGAGCAATGTGCCCCCCAC
AGCCCATCCATCGCACGCGAGTATGAGATCGTTTCTGCTGTGCATGACATCAAAAACAGGATCGGCAACGATTGCAGCGG
TAATGGCAACGGCAACGGTGGTGGCCATAACATCGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62