GenePrediction:GLEAN_7880 Details

Name: GLEAN_7880
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2452439..2451261 (- strand)
Length: 1179
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2452439..2451694 (- strand)
Length: 746
Type: CDS
Source: GLEAN
Position: GCSC_113:2451621..2451547 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_113:2451486..2451261 (- strand)
Length: 226
>GLEAN_7880 class=GenePrediction position=GCSC_113:2452439..2451261 (- strand)
ATGTCTTCAAACGGGACCGTCACGGCCCATCCATACAAGAAGTGCACAGCTGTGACGGACACGTGTCCCGTAACAGCCAC
GACGCAGGGCTACTATCCCAACCTGGGCATCAACTACTTCTTCGCCATCGGCTTCGGCATCGCAGCCGTCAGTCTCGTCG
TGACGGGCATCTGGAAGCGCACCTGGGGCTACTCGGGCTTCCTCGCGGCCGGTGCGGCACTTGAGCTCGCCGGCTACGCC
GCCCGCATCCCCCTGCACGCCAACCCGTGGGACCAGCAGGCGTTCGAGACGCAGATCTGCGCCATCATCCTGGCGCCGAC
GCTCATCTGCATCGGACTCTACCTCACGCTCAAGCACGCGTGCCTGGCATTGTGTCCGCAGCTCTCACGCGTCCGCCCGA
CCCTCTATCCGTGGATCTTTGTGCCCGCCGACGTCAGCTGTCTGCTCGTCCAGGCCATCGGCGGTGCTCTCGCCGCCTCG
GCCGGCTACACCAGTACCACGCTTCTCAGCACCGGAAATCACGCCATCATTGCCGGCATCGCCCTGCAGGTCGTCGTGCT
CGCCTTCTTTGGCATCGCCTCCCTCGACTACTACGTGCACGTGCACCGCCTGATCAACGGCCGCGACCGCCATGGCCTCC
AGCCTACGCCCGCCGCTCTCGAGCTATGGACCAACCGGGACTTTCGCATGTTCAGCCGTGCCGCGGCGGCAGCATATGTC
TGTATCCTGATTCGGTGCATCTATCGGTGCGTGTCTCTGCCCCCCTCCCACTTGGTTCAGTCGACCCGGCTGAATGAGGC
TGCTGACATTAAGCACAGTATCGCTGAGATGGCCGGTGGCTGGGGCAATAAGATCATGCAGGACCAGCCGTCATTCATTG
TGCTAGAAGGATTGTGAGTTGCCAGATCAGCGGTCTTCCGGTCTCAATACTGATACTAACGTTCCTCTTTCAGCATGATC
CTAATCGCTGTTTGCTTATTGGCAGCATTCCCGCCCGGATTCCTTTTCCCCCAGATGGCGATGGGCCGTAAGAAGAGAAG
AGCTGCTGCCCAGGAGAACGACGCGCCGATTGTGCACACGAAGGCCGAAAAGAAGAACGCCACCGCAGAAGCTCAGCGCT
CTGATAATCTCGAAGCGGGAACGGCCTATACACCATCGGAGGCCTTACATGAAAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62