GenePrediction:GLEAN_7881 Details

Name: GLEAN_7881
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2448678..2447155 (- strand)
Length: 1524
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2448678..2448596 (- strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_113:2448535..2447155 (- strand)
Length: 1381
>GLEAN_7881 class=GenePrediction position=GCSC_113:2448678..2447155 (- strand)
ATGCAGCCACAGGTGACACTCGTAGCTGCTGCCGATCTCGGCCACGGTCGAGGGCCCCGGCCGTTCTACAAGAGCGCCCA
GTGGTGAGTCCGAGGAGGTCCGTTGTGATGATTGCGTCGTTGTCGTCCCGCTCACACTGCCAGGTCTGCCGACGGCACCA
CTGTCATCACGTCTACTTCCGATAACCGCATCGTCAGCTATGTCCTCCCAGACGACCTGCTGGATCCGCAGCAAGATGGC
CAGCTCGAATCGAACTCGCTAGCTGCATCCGAATCTGACTCTGACTCTGACTCTGACTCTGACTCCGAATCCGATTCGGA
CGGCAGCAACTCCGGATCCTCGTCCACTTCGTCCATAAACTGCCGCCACCGCAGACTTGTTCCCCAGGGCCGTCTTTGCC
TGCCTGAACCTGCAAACGCCCTTGCCTCTGCACCTTACTACTCGCTCGCCCTGCCGTGGTCCCAATCTGTCCTCGTCTCC
TGTCGCGATCTGCCCATCCACCTGTACTCTCTCTTTCCGGAGGAGGGAGACAGCAGCAGCAGCAGCAGCAGCAGTAGTGT
TGCTCATGCTCGGCCTCGTCCGCTCGCTTCATACCCCCTCATCAAGACCGAGACCGAGGCTTACCTCGCTCCCAATGCCC
TGCTATGGCCTTCCCCGGGCACCCACTTCGTTGCCGGCACCACCAACCTGCTCGTCCTGTTCGACATTAGCCGCACAGCC
AACGACCCGCCCCTGTTGCGTGTGCCCACCATCGCGTCGACACGCCACCTGCGCAAGGGCAACGGCGTTGGAATGCGCGG
CACCGTGGCTGCGCTGAGCGGCAGCATTGGCCCCGGTCCCGGTCCCGGCCTTGTGGCTGCTGGCACATGGACCCGTTGGA
TCGGCCTCTACGACCTAGCCCGCGCTGGCGGCGAGTGCGTGGCCACCTGGAGTGTTGCCCGTGCAAGCTCCCGTGCAAGC
TCCCGTGCAGATTCTCAGCCAGGTGTTGACTCCATCGGCGGTGGCGGCATCTTGCAGACCCTCTGGAGCCCCTGTGGCCG
CTACCTGGTCGTGAACGAGCGTCGGTCCCGCGGCCTGCTGGTCTATGATGTCCGTGGCTCCGGTGAGCTGCTTTGCTGCC
TGACCGGACGTCCGGCCGAGACCAACCAGCGACTCAGCTGTGACGTATATATGAGCGCGTCGGCTCCAAATAACTCTTCG
GTGGAGGGAAAGGTGACTGACGGTAGCAACAACAACGGCAGTAGCGGTTTTGAAGTCTGGGCTGGTACCCAGAATGGCAC
CACGGTCGTGTGGGAAGGCATTGGCCGCTGCGGAGGGAATATCGAGCCGTCATGGAGCTGGATGGCCCACAGTTCGGCCG
TTAGTAGCACGGCTATGCATGCGAGTGGTTCTGTCATTGCCACATGTTCGGGCTCCTGGGCTCTTCCTGGCGATGACGAT
GCCAATGAGACCGACGATGCATCTGGCTATACAGCAGTGCGAACCAGCCCCGATACCACTTTGAAATTATGGACTTTAGC
CTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62