GenePrediction:GLEAN_7883 Details

Name: GLEAN_7883
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2438711..2433260 (- strand)
Length: 5452
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2438711..2438420 (- strand)
Length: 292
Type: CDS
Source: GLEAN
Position: GCSC_113:2438343..2437737 (- strand)
Length: 607
Type: CDS
Source: GLEAN
Position: GCSC_113:2437666..2437531 (- strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_113:2436803..2433624 (- strand)
Length: 3180
Type: CDS
Source: GLEAN
Position: GCSC_113:2433559..2433260 (- strand)
Length: 300
>GLEAN_7883 class=GenePrediction position=GCSC_113:2438711..2433260 (- strand)
ATGCCGCCGACCACGGCCGCCGTCGCGGCGGCTGGTGGCCCCGACGTCGATGCCTGGGCCCTGGGCGTGCTCAAGTCGCT
TGGCATGTCGTCCGATGCCCGCGGTACAGGTGGCGTTCCCCTGGGCATCCATATCGACGGGCTCGCCCACCGACCGGCAA
AGAAGACAGTCTTTGTACCCGACCAAGGCGCGCCGCTTCAGAACCTGCTGGCTCGCAGGGACAGCCAGCGACGACGGGAG
GCCGTGCTGAAGGGCAAGGAGGGCAGCCGGCACCGTCGCCGGTGGGAAAACGGTAAGAGAACCCGGATGGCTGTCGTGGA
CAATAGTTTGGACTGCTGCTAACGCCTCTGGTTGCCCCTATTTGCTAGACCGCCTCCTGCACGTGCCCAACGCGCAGCCA
CCGCTACCCAGCGACTGGGAGGTACGACCGACCCATCCGGTGCATTACGGCCTGCCCTACCACCTGGCTCAGTACTGGGA
CAAAGGTCTGCGCCAGCACGTCAACGAGACGCGTGCGGCCGCGGCCGTGCTGCGTCGCCGCCAGGTCGTGGCCCAGCAGG
CGGGCACTAGCATGGAGAAGTCGGGGAAGACGGAGAACATGCGTGTCGGCACGATTACGCGCGAGCTGCGAGCGACGGCC
AAGAAGACGCCGGCGGTTAAGACCTGGGTGCGCGTGCTGGAGGAGCCGGTGCGGGCGTTTCTGCAGGCAGCCGCAGCGGC
CAAGGCAGCCGGACACAGCCTGGACGGCAGCGACCGCGACGAGGGCTGGTCCTCGGGCGACGAGGAAGACAGCACGGCTC
CGTTCTACTCGGACGAGGAGGAGGACGAGATCGTCTTTGTCGGCCGCCACAACGCCAGTGGCAGTGCTGGCATGTGGCGT
CAGGCGCAGCAGCAGAAAAAGCCGCCGCGGCAGAAGCAGATCGACGGCGGCATCGTGTTTGACGAGCTCGGTGATGATCG
AGACGGCTCTTTCAAGTATGTCGGATCTCGTGGCCTTCTTGTTGTCCTTCTTTTGCCGTCTTTCCCCCCCGCTAACCTTT
CGCAGACGCTGGCTCACACACTCCATCTCGGACTACTACGGCCTGGCCTCGCACTCCGTCTCGGTCGACTCGCCGCCGCG
CCGGGTTGTCTACGTGACGCTGCACGAAGAGATGCGTGCGTCGACCGGCCCTCAGTTCCAGGTGCCGCGGCCAATGTGGG
AGCTGTTCTGAGCGGAGGCGTGCCGCTTTGACGGGAAACAGGGGCAGCGTAGACGCGGTGGGTACGTAGAGCATCTGGGT
ATCCTAGAAACAAGGGTCGGATCGGCGTGGTGTCGTATGCATCTTGACAGACGCTCGTAACGAATAATACAGGCGATTCG
CCCCGAGGCTGCTGCTGTGCAACGTTAGTCAGCACTGTCTGTCCTGTTCGCTGCTTCCTAGTCATTGCGGGGTACCTGTA
AGCGGGAAGGCGCATCCCACTGAGCACCAGCCAGCCGCTAAGGTGCTCTGGTGCTTGAAGTCCGGCATTGATTATGCTCC
CGCAATACAGCAATTGCCATGCAAATTGGCTTCACTTTCTGCGTTATCCGTTCGTCTGTCTCTCCGTCGACCTGTCTCGC
GCTCCCCGCACCTGCACGTTCGTCACGACACCTGTCTGCCCCCGCCGCCTGTCTGTTGGCAGCCACGGGGCTCTCTGTGC
AGCCGACGCCAATCGCCCCCTTGTCCGATCTTCCTCGTCCGGCCGTCGACGATGGCATATATTGCCCCCATTCACCGGCC
AAGCAGCGTCCGGCACGCGCTGCACATGAAGCTGTTATCGCCGACAGAAGAGAGCATTGTGGTGGCGTGCGACATTTCCC
TCCCCTGCTATCCGTTTGATCGGTGTCTGATCGAACCAGCGCTGACCAGATGCTGCTGCTGCAGAAAGGCCAACCGTGTT
GAGATATGGCGGATCACAGAGGACGACCACCTCGTGCTCTTCCACTCGCAGATGATCTTCGGCACGATCTCGATGCTGCA
GTCGCTGCGGCCGATCGACTCAAAGACGGAGCTGCTGTTTGTCGGCACAGACCGATTCGAATACTTCACGCTCACATGGG
ACATGGAGTCCCACAGCCTGCGGACGGTGGACACGTTCCAGGACGTAGGCGAGAAGCACCTGCGCGACTCGCAGAGCCAG
GACCGCTGCCTGGTTGATCCGTCGGGGCGGTTTATGGCGCTGTTGCTGTGGGAGGGCGTGCTGACGGTGCTGCGGCTGCA
GACGCGACGAGACCGAGCACGACCAGACCACATGCGGCATCTGGTGCCGATGGACCAGGTCCGTCTGTCGGAGCTGTTCA
TCAAGGCCAGCACCTTTCTGCACTCGGAGACGGGCCAGCCACAGATTGCGTTTCTGTACCAGTCACAGGGCGACCGCGCC
GAGGCCAAGCTGTCGGCGTACCGGCTGACGGCTGGCGACCGCAACGTCGACACCGGTCGCTTCGATGCCAACAGGGACCG
CGAGATCAGCATGGACATTGACGACCCTGGCGCGGCCCTGCTGATCCCGGTCGAGAAGGTCGAACCGGCAAAGCGGCACA
ACGTACGCAACACGGCTACGGCTACGGCTAACCTCGGCGGCCTGCTCGTCGTCGGTGAGACCCGGCTGCTCTACATTGAC
AGCACGACCAAGTGCACGGTCGAGGTGCCGCTGCGGGCTGCCTCCATCTTTGTGGCCTGGGCGCGCTACGACGCCACCCA
CTACCTCCTGGCCGACGAGTACGGCACCCTCCACTTGCTCACCATCCTTGTCAGCGGCGCCGTTGTCGATAATCTCGATG
TCAGCCCGATTGGCAAGACGTCACGCGCCAGCTGCCTCGTCTACCTGCCAGACCGGCGTCTGCTCTTTGTCGGCTCGCAC
AATGGCGACTCGCAGCTGTTCCGTCTCGACCTCGCCGCCAGCCCCGTCGGTCTGCACGAGCTGCAGGTGCTGCAGAACAT
CGCCCCCGTGCTCGACTTTACCGTCATGGATATGGGCAACCGCGAGGATGACCAGCAGCTGGCCAACGAGTACGCGTCCG
GTCAAGCCCGCATCGTCACCGGCAGCGGCGTCCACAAGGACGGCAGCCTGCGCAGCGTCCGCAGCGGTGTCGGCCTCGAG
GACATTGGCATTCTCGGCGACCTCGGTGGCGTCCGTGGCCTCTTTTCACTGCGCTCGCCGCAAACCCAGCAGCAGCAGCA
GGTCGACACCCTGGTGGCTTCCTTCCTGACCGAGACACGCGTCTTTTTGTTTGACGGCGACGGAGAGATCGAGGAAGTCG
AGGCATTCCCTGGCCTGAACCTGGGCACACAGACACTGCTGGCCACAAACCTGTCTAGTGGCAGTAGCAGTAGCAGCCGT
CTTCTACAGATCACGCCAGGGTCCGTGACGCTCGCAGAAACTGCCAGTGGCACCATCGTCGCGTCCTGGACGCCACCGGA
CGACAGGACGATTGTCAGTGCGTCTGCTAATAGCCGCTGGGTGCTGCTGTCTGTAGAAGGTACGACGCTCGTGTCGCTCA
GCCTCGACAACAGTTTGGCTGTGGCAGCACAGAAGGAGGTTGGGACGACGGATCAGATTGCCTGCCTCCACGCGGCCCCA
CAGCTCCTAGACGTCGGTGTGGTCGGGCAGTGGGCGTCGGGGATGGTCTCAGTAGTGGACCTGGCCACGCTGGAGCCGAA
GCACGGCGGCAAGTCGCTGCGCCGGAGGGACGACAACGCGTCGGTGCCGAGGAGCATCGTGCTAGCCCAAGTGCTGCCAC
CCGGAATGGCGGGCCCGACGCTGTTCGTGGCCATGGACGACGGCAACGTGATCACTTTTGCGGTGTCGCCGTCTGACCTG
TCGCTCTCTGGCCGGAAGAGCGTGGTGCTGGGAACGCGACACGCCCGGTTGCACCCCCTCCCGCAAAGTGACGAGGCCAC
GTACAGCATATTTGCAACGACAGAGCACCCCAGCCTGATCTACGGTTCCGAGGGCAGGATCGCGTACGCCGCCGTGACAG
CCGAGGACGCCAACTTTGTGTGCCATTTTGACGCAGCGGCATTCCCGGGCGCCATCGCAGTAGCGACGGACTCACAAATC
AAGCTGTCGCGCACCGACACCACGAAGCAGACGCACGTGCGGGCGATCGACATGGGCGAGACGATCCGGCGGATTGCATA
CTCGGCGACCGAGCGGGTGTTTGCACTCGGCTGCATCAAGCGGGAGCTGACACAGGGCCGGGAGGTGGTGACGAGCTCGC
TCAAGCTGGTGGACGAGGTGGCATTCCAGCCACTGGGAAAGCCGCTGGCGCTGGAGGTGGAGGGCACCGAGCTGGTCGAG
TGTGTGGTTCGCGCAGAGCTGCGCGACGCCCTGGGCAACCCGGCCGAGCGCTTTCTAGTGGGTACGAGCTTTATGGCGGC
CGGGTCGAGCGAGAACGAGCACACGCTCGGCCGGATCCTCGTTGTCGGCGTCGACAGCGACCACAGCCCCTACATTGTGT
CTTCACACCGGGTGCGCGGCCCGTGTCGCTGTCTGGCCATGGTGGACGACCTGATCGTGGCCGGCCTCAGCAAGACGGTG
GTGTTGAGCCGATACACGGAGACGTCGAGCATGTCGGGCGAGCTGAAGAAGGTGGCCTCGTACCGGACGGCCACATACGT
CGTGGATCTGGCCGTGGACGGCCACATGATCGCGGTGGGCGATATGATGAAGTCGACCGCGCTGGTGGAGTACATTCCGG
CAACGTCAGGCGATGGGGAGGACGAGGAGGATGATGGCGCGGGAGACAACAAAAAAGGCAAAGGAAAGACGGCAGACCGA
AGCAAGACCATCGCAGAAGGCCCGAAGCTGGTAGAGAGGGCTAGAGGCTACCAGGCCAGCTGGGCGACGGCGGTGTGTCA
CGTGGAGGGTGACCTGTGGCTCGAGGCCGACGGGTTTGGCAACTTGACGATGTTGGAGCGCGACGTTCAAGGCGTGACGG
CTGACGACAAGCGGCGGCTGCGGACGGTCGGCGAGATGTATCTCGGCGAGATGGTCAACCGGATCCGGCCGATTGCCGTG
GAGACCAGCCCGGGTGCTATGGTGCATCCCCGGGCGTTTTTAGCAACGGTACGTTTTGTTTGGCCTTTCGTCCTTCTTCG
GGCTTGGCTACGTGTCCTTTCTAACTTTCCAGGTCGAGGGATCTATCTACATGGTCGGCACGATTGCGCCGGAAGCCCAG
GACCTGCTGATGAACCTGCAGACGAAACTGGCGGCCATTGTCAAGGGCCCCGGAAATACCAGCTTCTCGGCGTATCGCAG
CTTCCGTAACGCAGAGCGCGAAAGCACAGAGCCGTTCCGGTTCGTCGATGGCGAGCTGCTAGAGCGCTTCCTCGACGTCG
GCGAAGACGTGCAGAAGGAAGTTGCCCAGGGCTTAGGCCCCAGCGTGGAGGACCTGCGGAACATTATCGAGGAGCTGAAG
CGGCTACACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62