GenePrediction:GLEAN_7885 Details

Name: GLEAN_7885
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2429287..2426664 (- strand)
Length: 2624
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2429287..2428281 (- strand)
Length: 1007
Type: CDS
Source: GLEAN
Position: GCSC_113:2428232..2427418 (- strand)
Length: 815
Type: CDS
Source: GLEAN
Position: GCSC_113:2427136..2427012 (- strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_113:2426801..2426664 (- strand)
Length: 138
>GLEAN_7885 class=GenePrediction position=GCSC_113:2429287..2426664 (- strand)
ATGGCGCCTAGGGTCCTTGTCCGCCTGTCAGGGCCTGCAGCACTTCTCATCCTCTGCCTTCTCACCGACTGCGCTGCTGC
CGGCGTGCTCACTCCACAGAAGGTACGACGAGTGCGGAAAGCAGGCACGCCCTGGCCGACACAAATACACGTGGACGCAA
CCGTGATGTCGTCGCCTTCTGCACATTCTTCACCACTGCCAGCACCGGCGGCGGTACCGCCTCCAGCCAGTACCACCGTG
CCGCATCGTCTGCTCAGCGTGGTTCCATGGCCTCGGCCGACCGATGGCCCGGCTGCTACTGCTGCTGATTTCGCTGGCAC
GGCTCTAAATGAGCTTCTGCGTCGCGACTTAAACACCATATGCGGTTACATTGGCGGCAATCCCGACCTTCCTGCCACGT
GCTCGGTTGGCAGTCATTGTGTCCTCGACACGGAGCACAGTGCCGTAGGTTGCTGTCCAGATAATGCCGCGTCCTGCACG
TCGGGCGTGTACACGGGGTGTTTGGATGGCGACAGCAGCACACAGAACGAGGTGAATCCATACGTCTACACATGCTCGGC
TAGCAGTGTCTGCTACAAGAACGAGTTCAGCGGCGGCTACTATCAGTATGGCTGCGGCTCGGCCAGCGACATGGGGACAA
CCGTGGCCATGTCTGCTACCGGCATGTCGTCGTTGCTCGACTTGAGCAGCCTGCAGGTCAGCTTCACAGAAACAATACAG
TCGTCGACGTCGGCGCCGTCAGCATCGACAAAAGCAACAGCCCATTCTTCAGCTTCTTCGGCTTCTTCAGCATCTTCATC
ATACTCCTCCTCTTCGACTTCCCCAACGTCCCTTTCCACCCCAACTACTTCCTCCAAACTGCCAAACAGTAGCGACCGTG
ATCGAGCAGGTATCATCATTGGCGCTACCATCAGCAGTGTGGCTGGTCTGATAGCTATCCTTGCTCTCCTGGTCTTCTGT
TTCTGGAAGCGTCGGGGGGGTAGCCGCCGCAAAGGTCAAAATTTGAGGTAAAGCATGATAACTTCTCTTCATTCTGCCTC
GCTCTGCTTACACAGACACAGTCCCGCATCGGGCAATTTCCAGGCTCTGCATGGCACTGCCGAGGATTTTGAGACGGGCT
TGCGGCCCGAGATGGCCCAGGCAGAACCGCTGACGCCGAAGCGGCGGACAAGTTACGGTCGATGGCCATTTTCCGAAGAT
GTAGATGAAGACGAAGCCTGGGTGACGCCTGCCATCGGACCAGCAGCGGCGGCAGCAATCGCGGCGGCGGCAGCAAAGCA
CGGCAGAGGAGCCGGAGCATCGGAACCGAGGCAGCGTCCTGAGAGCAGTTATCGCGGCGTAAAAACATCCGCAGCCAGCA
CTCCTAGACCTAAGGCACCGGCGACCTCGCCACCCATGACCGGCATGCCGACACCGCCGCCAGCAGCGGCGTACTTTCAG
ATGTCACCGTACGGCGGTGTTGTGCATGAATCAGAAGAACAGCTGCCGCTGACGTACGACCGCACGGACTTTACTACGCG
GAGCGGACAACAGGCAACGCTGAGCCGGATCGGTGAAGAGAGCGACGATAGTATCAACGGTAGTGGTGGTGGTGGTGACG
GTAACGGTGACATAAACGGAGATATCAACACCAGGAGCGGAGGCAGCCGCACAAACAGAGCAAGGAAGCTGAGCTTCGAC
GACGACCCTGAGGAGCTGCAGGTGAAGAGTAGAATACGTGGTGGAGGCGAATCCGGCACGAACAGTACAGGAAGCGGCGT
AGGTGCAATCTCGACGGCAGGAAACCCGACGGTGGACCTGGACGGCGGCCTCACGAAAGGAGACAGCGGGCTCGCAGAGA
TGCCCGGCACGCCGATAATACGGGCGGATGGTCCGTTGTGGCAACAGAATCGACAGCGAAAGCGGAACCTGCAGTGGTTA
TGACGAGGGAGAGAAGACGAGATCTAGAATTCCGTTGTCCTTATTCAGCAGCAAAACCGTCAGCGTAGCATTGCATATTT
AGCGGGATTTGGTCAGTCAGCACATGGAATTTCAGCAACAATTTAATTGTCCGGGGACACTGTCGATCTGGAAGCTGGGC
ATCGCTTGTATTTAGAAGAAGTTGCATGAACGCCAAGCCATACGAGCACAATACGAGTACTGCTTATCAAGAACACGGTG
GGGGATGTCCCCTGCTCTGTTTTGCATACGACAATGGTGGAGAGCAGGCGATGCGGCAGTCGCAATTTTCACCACTTTCT
AGCACGTTCTACGACTGCACGCGGGAAGATTACGTTGTAAGATACGGAGTACTCCGTACATTGGTGGCAAAACCAGCTCT
TCCACCTGGCAGCCACGCTATGACACTATGACATACTCCGTACTTCAACAGCAGTTGACAAATCTTGCGGTGGGGTTTGC
AGGCACCGTAGGCCCCACTCTTCAGCGCTGTCGAGAGCCGTGCTCAGTGTTAGCACCTGCTTGGAAGGGTGCTGATTTGT
GAACAGCACAGCAAAAGTGGAAGAACAAAGAACATCTGGGATGCCTGGGACGGGACAGGACGACGCATGGCTGCGATGTT
CTTGGGTATAAGAGGGGCCATCTCGCTGCCGTCTCTGCTGCAGGTCGTCGGGTCCAAGAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62