GenePrediction:GLEAN_7887 Details

Name: GLEAN_7887
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2421657..2419923 (- strand)
Length: 1735
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2421657..2421236 (- strand)
Length: 422
Type: CDS
Source: GLEAN
Position: GCSC_113:2421165..2419923 (- strand)
Length: 1243
>GLEAN_7887 class=GenePrediction position=GCSC_113:2421657..2419923 (- strand)
ATGGAAGACGTAAAGGAGCCGTCGAAGAGTGCGCTGAAGAAGGCGGAGAAGGCGGCCAAGATGGCACAGGCCAAGGCCGA
CAAGGCAGCCAAGGCGACGACGGTGGCCGTTGTGGGTGGCAAGAAGACGGACGACATTATCGGCATCACGGTGTCGAAGA
CGGACAACTTTGCCCAGTGGTACCAGGAAGTAGTGCTCAAGGCCGAGATGATTGAGTACTACAACGAGATTGCCGGCTTC
TACATTTTGCGGCCGGCGTCCATGTATATCTGGAACGTGATCCGGAAGTGGTTCCAACAGCGGATCGAGCACATGGGCGT
GGAGGAGACCAGCTTCCCAATGTTCCTCTCGGCTAAGTCACTCGAGAAGGAAAAGGACCACGTCGAGGGCTTTGCCCCGG
AGCTGGCCTGGGTGACCAAGGCGTGAGTTTTTCTTCTATTCCTTTTTTCTTCTGTTCTCGCCAGCTCCTCTTTCTTCCCG
CTGACCAGCCAGCGGCGACAAGGACCTCGAGGTGCCCGTGGCCGTGCGGCCGACGTCTGAGGCGGTCATGTACCCCTACT
ACTCCAAGTGGATCCGCAGCCACCGCGATCTGCCCCTGCGGCTGAACCAGTGGAACTCGGTTGTGCGCTGGGAGGCCAAG
CAGACGACGCCGTTCCTGCGGGCGCGCGAGTTCCTCTGGCAAGAAGGCCACACGGCTCATCTGACCGAGGAGTTGGCCGG
TGAGGAGGTGCTCGAGATCCTCGAGCTGTACGCTGGTGTCTACGAGCAACTGTTGGCGGTGCCGGTCGTGCGAGGCCGCA
AGACAGAGAACGAGAAGTTTGCCGGTGGCTACTACACCACCACCGTCGAGGGCTACATTCCAACCAACGGCCGTGGCATC
CAGGGCGCCACGTCGCACTGTCTCGGCCAGAACTTTAGCAAGATGTTCGACATCACCGTCGAGGACCCCCAGGTCAAGGG
CCAGCATCGCCACGTCTGGCAGAACTCGTGGGGTCTCTCGACTCGCGTCATCGGTGTCATGGTCATGATCCATGGCGACG
ATAAGGGCCTCGTCCTGCCGCCGCGTATCGCCAAGATCCAGGCCATCCTTATCCCCGTCGGCCTCAACGCTAAAATGACT
GCCGACGAGAAGGCCGCCCATGTCGCCCGCTGCGACGAGCTCGCCGCCCAGATCAAGGCCGCCGGCGTCCGCGTCGAGGT
CGACGTTCGCGAGGGCTACACTCCCGCCTGGAAGTTTAACGACTGGGAGCTCAAGGGCGTCCCCCTGCGCCTTGAGTTCG
GCCCCAAGGATCGCGAAAAGAACGTGATCAGCTTCGCCCGTCGCGACACTGCTGAGAAGGGCACCATCCCCCTCGGTGCC
CTCGCCACCGACATCCCTGTCCTGCTCGAGACCATCCAGAAGGCCATGTACGACAAGGCTGACGCCGCCTTCACCTCCCA
TCGCCTCATCATCAACGACTGGGCCAAGGTTCTCCCTGCCCTTGACGCCAAGAACGTCGTTCTCATTCCCCACTGCCTCG
ACGGCAAGTGCGAGGACCGCCTCAAGGATCTCACCAAGAGCGACGAGATCATCGAGGGCCCCGACGGCCAAAAGGCCCCC
ACCATGGGCATGAAGAGCCTGTGCATCCCCTTCGACCAGCCGAAGGAGGGCCTCGTCCAGGGCGAGACCCAGTGCCTGAA
CCCCGAGTGCACTCGCAACGCCGAGAAATGGGTCATGTTCGGCCGCAGCTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62