GenePrediction:GLEAN_7888 Details

Name: GLEAN_7888
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2394232..2392224 (- strand)
Length: 2009
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2394232..2392354 (- strand)
Length: 1879
Type: CDS
Source: GLEAN
Position: GCSC_113:2392291..2392224 (- strand)
Length: 68
>GLEAN_7888 class=GenePrediction position=GCSC_113:2394232..2392224 (- strand)
ATGTTGCCACGAGATCTGTCGCCGTCGAGCGCGGCGGCGCTGGTAGCCTCCCTCCTCATCCTGCCACAGACGGTGTCGGC
ATTTTATCTTCCGGGCGTGGCGCCGACGTCGTACCGACCTGGCGATACGGTTCCCCTCTACGTGAACACGATACAGCCGA
TCGCTGCCCCGCAAGATGCGCGGCTGCACTCGATCGTGTCCTACGACTACTACCTGTCGCAGCTCCAATTCTGCCGGCCA
GAAGGTGGCCCCAAGCACGTGGGCGAGAGCTTGGGCAGCATCATCTTTGGCGACCGCATCATGACATCGCCGTTCGAGCT
CAAGATGGGCGTCAACGAGAAGTGCAAGCCGCTGTGCGCGACGACGTACGAGAAGGACTCGGCCGAGTTCATCAACAATC
TGATCGAGGAGGGCTACAGTCTGAACTGGCTCGTGGACGGGCTTCCGGCGGGCCAGGAGATCGTCGACGAAGTGACAGAC
ACGGAGTTTTACAGCCCCGGCTTCCTCATCGGGCAGGACGGCGGCGACAATACGATCGCCTTCAACAACCACTACGACAT
CATCGTGGAGTATCACGAGGTCAGCGGCAACCCGGACCAGCTGCGGGTGGTGGGCGTGCTTGTGCAGCCCAGCTCGCTGG
ACTATGCGGACACTAACTCGGTGGACTGCGCGCTGGAGCACCGGCCGCTCGTGCTGGCGACCGGGGCCGGCAGCCAGACA
AAGGTGCAGTACACGTACTCGACGTACTGGACGCCGTCCAAGACGGCGTGGGCAACGCGCTGGGACAAGTACCTGCACGT
CATCGACCCCAAGATCCACTGGTTCTCGCTCATCAACTCGGCCGTCATCGTCGTGTTCCTCGTCCTGACGGTCACGTCCG
TGCTGGTGCGCACGCTGAGGAAGGATATCGCCCGCTACAACCGGCTGGACCAGATCAACCTGGACGATCTTTCGGGCAGC
GGCGGATTCGACGACGGCGTGCAGGAGGACTCGGGCTGGAAGCTGGTGCATGGCGATGTGTTCCGCACGCCGGCGCGGCC
GCTGCTGCTTTCCGTCTTCCTCGGCAACGGCGCCCAGCTCTTTGTCATGACTGGCTTCACCATCCTCTTTGCCCTGATGG
GCTTCCTCTCGCCGTCGAACCGCGGGTCGTTGGGCACGATCATGATCCTGCTGTACACCGTGCTCGGATTTGTCGGGGGC
TACTCGTCTGCACGCGTCTACAAGTCTTTTGGCGGCGAGCAGTGGAAGCTCAACATCGGGCTCACGCCGCTGCTCGTGCC
CGGCTTCGTCTTTTGCATCTTCTTCCTGCTGAACCTCTTTCTCTGGGCGAAGCAGTCTTCGGGCGCCGTGCCCTTCACCA
CCATGCTGGTGATCATCAGCATCTGGTTTGTCATCTCCGTGCCCCTGTCCTTTGCTGGCTCGTGGCTCGGCTTCCGCTCG
GCAGCTATTGAGGCCCCGGTGCACACGAACCAGATTCCGCGACAGATTCCTCCCACGACGACGTACCTGAAGCCTATCCC
GAGCATGCTCCTGGTCGGCATCCTGCCGTTTGGCGCCATCTTTGTGGAGCTCTACTTCATCATGAGCAGCATCTGGTTTA
GCAAGATTTACTACATGTTCGGCTTCCTCTTCCTGTGCTACGGCCTGATGATCATCACATGTGCGGCCGTCACCGTTCTC
ATGGTGTACTTCTTGCTCTGCGCCGAGAACTACCACTGGCAGTGGCGGTCATTCTTGGCTGCAGGCACGACGTCTGTGTA
CATCTTTGCCAACGCCATCATCTATTGGGTTAGTAAGCTGAGCCTCAGTAATATGTCGGGAAGTGTGCTCTACGTCGGCT
ACACGCTCCTGATCAGCTTTCTATTTTTCGTCCTGGCCGGTATGTCTGTTCCCTCCAAACGTTTGCACTGCCGAGCTCGT
TCCACTGACACTCTCGAATAGGATCGATCGGCTTCTTCTCCAGCTGGTGGTTTACCCGGCGCATTTACTCGAGCATCAAG
GTGGATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62