GenePrediction:GLEAN_7889 Details

Name: GLEAN_7889
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2389551..2388955 (- strand)
Length: 597
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2389551..2389494 (- strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_113:2389426..2389271 (- strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_113:2389214..2388955 (- strand)
Length: 260
>GLEAN_7889 class=GenePrediction position=GCSC_113:2389551..2388955 (- strand)
ATGTGCTCCTGCGACTTCTTTCTCGGCATGCTAGCACTGCTGTTTCCCCCACTTCCTGGTGAGTTGAATCCCACGATCAC
GGAGGCCGCTCGCGATCTGCCTGCGCAATGCTAACAATCCCTCAGTGTGGGTCAAGCGCGGCATCTGCTCGGCCGACTCC
ATCATCAACATCCTCCTCTGCCTGCTCGGATACGTGAGTCTCTCTCTCTCTCTCTCTCCCTGTTCGGCCCGCGTGTTCTG
GCTACTAACTCGGCATAGCTCCCGGGCCTGGTTCATGCTTGGTACATCATCGTCAAATACCCCGAACCCGAGTTCGCATA
CGATGGCCTGTCTCAAGATGCAGAAGGCTCTATCCAAAACCGTCGCTTCACCTACATCGTCGTCCAGCCTTCCGGCGGCC
GCCCGCAGCCACAACCACAGACGGCTGCGCCCGAGATCCAGAGCAACATGAACTACGGAACGACAGCCCCGGCTGCTGCC
TCTTCCTCCTCCGCACAACAGCCCAGAAACGATGCCGGCGAGGGTGGCAGCAACGGGCCGCCGCCGAGCTACGCTCAAGC
TGTATCGAGCGACAACAAGATCCAGAACCACGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62