GenePrediction:GLEAN_7891 Details

Name: GLEAN_7891
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2383470..2379573 (- strand)
Length: 3898
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2383470..2381364 (- strand)
Length: 2107
Type: CDS
Source: GLEAN
Position: GCSC_113:2381309..2381182 (- strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_113:2381119..2380960 (- strand)
Length: 160
Type: CDS
Source: GLEAN
Position: GCSC_113:2380903..2379573 (- strand)
Length: 1331
>GLEAN_7891 class=GenePrediction position=GCSC_113:2383470..2379573 (- strand)
ATGGAGGACCTTGAGTCACTCGAGGTCCTCTCGCTCGTGGCAAAGGTTGCCTCGGAGCTGGAGAACCATCTGGGTATGGA
CAACAAGGATGTTGCCGAGTTTATCATATTCCAGCGCCTCCAGAGCGACGGCTTCGAAGCTTTCCAGAAGAAGCTCACAG
AGCTTGACGTCGACTTCCCGCCAAGTTTAGTTGAAAGTATCGACCGACTAGTCTGTACGATGCATCCTCAGATGCGGGCG
AGAGCAGCAGCAGAAGCGAAAGAAAATGCGGCGAGCAAAGCAGCCCGATCGAAACAGATTTTCAAAGGCTTGACCGTACC
CGACAAAGAGCCAGAGCATGAAGCCGATGCCATTGACGACACACTGGCACTACTGGAGGGCCTTGAAAGCAAGGTGAGGA
AGGAAAAGTCATCACGACCAGTGGCAGTGGAGACAGCATCACGGAGAAGTCAAAGTCCCCGAGACGACTACAACAAGACG
AAGCGAGATGGAGGCCGGGGGCAAGATCGGCGATCTCGTTACCGGTCGAGATCGCGGTCGGAGTCCCCACGCTCAAGGTC
AGATTCCCGTGGGCGAAAGAATATAAAACGATACGATTATGACGACCAAGACGACGACTACGCGAACTATAGTGGTAGTG
GAAAGCGAAGCAGGAGAGAGAACGGCAAGAGTGGAAGAGGACGTGCAAACAGAAACGGGTATGACAACTATGACGATGGC
AACGGCAACGACGGCCGGTCTCAGCGGAAAGAGGTGGAGGTGGATGACGCTCCAGAGCTTTTCAAGGTGTACGACGGTCA
TGTCACGGGAATCAAAGATTTTGGCGCTTTTGTGAATCTTCACGGCATCCGGGGCAAGGTCGACGGCCTGGTGCACGTTT
CGGCCCTCGTTGACGGCCAGCGCGTCAGCCATCCTTCAGACTTGTTGACTATGGGCCAAAAGGTGCTGGTCAAGGTTGTG
AAGATAGAAGGGAGCCGGATCGGCTTATCGATGAAGGATGTGGACCAGGACACCGGACTGGATAACGCCCCTGAAGACAG
GATTCAGTCTGGAGCCAATATGGAGGCGCTTGGCGTCCGAGGTGCTGGCGGCATCAGCAGCAGTATTGTCACACCGCTAC
CCGGGGCGGGTGCATCAGGGGCAGGAGGCAGCGGCCCGGCAGGGAGGCGTGGCAAGAAGCGCATGACGTCTCCTGAGCGG
TGGGAGATTCTGCAGCTGATAGCCAGCGGCGTGGCCAAGGCGTCGGACTATCCCGGGCTCGAGGAGGAATACACGTCGAC
GCTGACGGGCGAGGGTCAGATGGAGCTGGAGGAGGACGTGGACATTGAGATCCGAGACGAGGAGCCACCATTCTTGGCGG
GACAGACGAAACTTTCGTTGGAACTGTCGCCGATCCGTGTTGTCAAAGCGCCCGACGGCTCGCTCAACCGTGCAGCCATG
GCTGGCGGGGTGCTCGCCAAAGAACGCAGGGAAACACGGCAGCAGGAGGCGGACGAGGCGAAGGCGTCGTTGGAGAAGGA
GAAGGTGGATCTGACGTCGCAGTGGCACGACCCGTTGGTGAATCCGGAGCAGCGCAAGTTTGCCAACGACGTGCGAAACG
CCCACAGCCAACGGAATGCCGCTCCAGAGCCAGTGCCGGAGTGGAAACGTGTCATCCAGAGCAAGGAACAGTCGTTTGGC
AAACGCACATCACTCAGCATGAAGGAGCAGCGCGAGACGTTGCCCATTTTCTCCTTCCGCAGCCAGCTCATCAAGGCGGT
GCAGGAAAATCAGATTCTGATCGTGATTGGCGAGACGGGATCCGGAAAGACGACGCAGCTGACGCAGTACCTGGCTGAGG
CTGGGTTGACGAACCGCGGCAAGATGGTTGGCTGCACACAGCCACGACGGGTGGCGGCAATGAGCGTGGCGAAGCGCGTG
TCCGAGGAGGTGGGATGCCAACTGGGACAAGAGGTCGGCTACACGATCCGGTTTGAGGACTGCACGAGCCCGTCCACGCG
AATCAAGTACATGACAGACGGCATGCTGGAGCGTGAGATCTTGCTGGACCCAGAACTGAAGCGGTATTCGGTCATTATGC
TGGACGAGGCTCACGAGCGGACGATTGGTGAGTTGCGGGTGCCCCGTTTGTGACTGTCCTGGTGTACTGACCATTCCATA
GCAACCGATGTTCTCTTTGGGTTGCTCAAGAAGACGGTAAAGAGACGGCCAGACCTGAAAGTCATTGCGACGTCGGCAAC
GCTGGACGCAGAAAAGTTCTCTACGTTTTTCAATGGAGCGCCTATTTTCGTATGTACCTCCTGTCCGCTGACAGCGACCT
CCATATGCCGATTATACTAACATTGCTGCAGACAATTCCTGGCCGAACATTCCCAGTGGAGATTCTCTACTCGCGAGAAC
CGGAATCCGACTACCTCGATGCCGCATTAGAGACAGTTATGCAGATTCACCTGACGGAGCCGGCTGGTGATATCCTAGTC
TTCTTGACTGGCCAGGAAGAAATCGATACCAGTATGTTGCATTCTTCGAGCCAGCGGATATGTCCTTGATGTACTAATGC
GTTTCAGGCTGTGAGATTCTCTTTGAGCGGATGAAGGCTTTGGGGCCTGGCATGCCGGAGCTGGTAATTTTGCCAGTGTA
TTCGGCGCTGCCGAACGAGGTACAGTCGCGAATCTTCGAGCCGGCTCCGCCAAATGGCCGCAAAGTAATCATCGCGACGA
ACATTGCGGAGACCAGCCTGACTATCGACGGAATTTTCTACGTGGTAGACCCCGGGTTCGTCAAGCAGAACGCGTACGAC
CCGAAGCTGGGAATGGATTCGCTGGTGGTAACACCAATTTCGCAGGCGCAGGCGAACCAGAGAGCAGGCCGTGCAGGACG
AACGGGGCCGGGCAAATGCTTCCGGCTGTACACGGAGGCGGCATACCAGACGGAGATGCTGCCAACGACGATTCCGGAGA
TCCAGCGCAAGAACCTCAGCAACACGATTCTGATTCTCAAGGCGATGGGGATCAACGACCTGCTGCACTTTGATTTCATG
GACCCGCCGCCGATCAACACGATGCTGTCAGCACTGGAGGAGCTGTATGCGCTGTCGGCACTGGACGACGAGGGGCTGTT
GACGAAGCTGGGACGCAAGATGGCGGACTTCCCGATGGACCCGACGTCGGCCAAGGCGCTGATTGCATCGGTGGAGCTGG
GGTGCAGCGACGAGATGCTGAGCATCATGGGGATGATTGCACAGCCGAAGGGAGTGTGGTACCGGCCGAAGGACAAGCAG
GCGCAGGCGGACGCGAAGCGGGCCAAGTTCAACGACCCTCACGGAGACCACTTGACGATGCTGAACGTGTACAACAGCTG
GAAGCGGAGCAAGTTCTCGAAGCCGTGGTGCCAAGAGCACTTTCTGCAGTACCGGGTGCTGATGCGGGCCAAGGACGTGC
GGACGCAGCTGGAGCGGATCATGGAGCGGTACAAGCACTCGGTGGTTTCGTGTGGTGCGGACACGAACCCGGTGCGCCAG
GCGCTCTGCGCGGGCTACTTCCGCAACGGCGCACGCAAGGATCCGCACGAGGGCTACAAGACGCTGATCGAGGGCACGCC
GGTGTACCTGCACCCGTCGAGCGCGCTGTTCGGCAAGCAGGCAGAGTGGGTGATCTACGACACGCTGGTGCTGACGACGA
AGGAGTACATGCAGTGCACGACGTCGATCGAGCCCAAGTGGCTGGTGGAGGCGGCGCCGACGTTCTTCAAGCTGTCGCCG
AGCGACCGGCTCAGCCGGCGGCGCAAGGCCGAGCGGATCCAGCCGCTGTACAACAAGTTCCAGACAGAGGACGACTGGCG
GCTCAGTGCGCAGAAGCGGAGTGGCCGTGGTGGCGGAGGTGGTGGCACATGGGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62