GenePrediction:GLEAN_7894 Details

Name: GLEAN_7894
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2368086..2366715 (- strand)
Length: 1372
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2368086..2368064 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_113:2367988..2367851 (- strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_113:2367779..2367682 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_113:2367604..2366715 (- strand)
Length: 890
>GLEAN_7894 class=GenePrediction position=GCSC_113:2368086..2366715 (- strand)
ATGCCCAACATTGTGGTAATTGGGTACGCTTGTCTTTTTCTTTCGCTCTCTCTTCCACACACACACACACACATCTGCTG
ATTCCACCCGGATCACAGCGCCGGCGTCTCCGGGCTCACGACCGCCCTGTTGCTAGCCCGCGACAAGGCCAACACGGTCA
CCGTGGTCGCACGCCACATGCCAGGCGACTACGATGCCGAGTACACATCGCCATGGGCGGGTGCTAACGTGCTGCCGTAC
GCGATGCCCCTCTTTATCTCGAAAGAAGGCTTGCCCGAGACTGACTGCCTTCTCTGCGCCTGAACAGGATGAGTCACGAG
GCCGACAGCCGATACGAGCGCGAGACCTGGCCGGAGCTGAAGCGGCTAGCCGAATCGGTGCCGGAGGCCGGCATACACTT
TCAGAGTAGGTGCGCAGCTGGGCGGGCCGACGAGACGAAGCCGAAGACGACGCAGCTGCTGACGCGCGGACGACGACAAT
AGGGGCGACGCTGTGGCGGCGGCAGGTGGACCTGGACAAGCCGCGGCTATCGGACGCGCTCTTCTACGAGAACCCGTGGT
ACCGCGACCTGTTTGACGACTACCGCGAGCTGGCGGCGTCGGAGCTGCCGCCGGATATCCGGTCGGGCGCGACCTTCACG
TCCGTGTGCATCAACACGATGCTGTACCTTCCCTGGCTGGTGGGCCAGTGCCGGGCGCTGGGTGTGGTCTTCCGGCGGGC
CGTACTGGCGCACGTGGAGGAGGCGGCCGCGTACGGCGGGCTGCTGGTGACGCCGGCCGGCACGACGGCACTCAACCCGC
AGACACGGCCGGCCGAGACGATCGTGGTCAACTGCAGCGGGCTGCTGGCTTGCCGGCTGGGCGGCATCGAGGACACGGCC
GTGCAGCCGGCACGCGGCCAGGTCGTAGTCATCCGCGAGGAGCTGGAGCCGATGCTGGTGACGTCCAGCGCCGGCGATGG
CGTTCCCGGCGAGCTGCTCTACTCCATGCAGCGGCCCTGTGGCGGTGGCACCATCGTCGGCGGCACGTACCAGGTCGGCA
ACTGGGACGGCCAGCCGGACCCCAACACGGCCGCCCGCATCCTCGCCCGCATCGCCGAGCAGCACCCACAGCTGCGCCGC
AGAGGAACGCGCGCCTGTGACCTCAGCATCGTCCGTCATGGCGTCGGCCTACGCCCCTACCGTGCCGGCGGCGTCCGCAT
CGAGGCCGAAAAGCTGCCTGGCAGCCCCAACGGCCCCTGGATCGTCCACAACTACGGTCACGCCGGTTGGGGTTACCAGG
GCTCGTACGGCTGCTCCAAGCACGTCGTCGAGCTCGTCCACGAGGTTATCGCCAAGACCAGCGCCGCCAGGACTGTCAAG
GCGTCTCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62