GenePrediction:GLEAN_7895 Details

Name: GLEAN_7895
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2365802..2364278 (- strand)
Length: 1525
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2365802..2365758 (- strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_113:2365678..2365641 (- strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_113:2365461..2365455 (- strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_113:2365271..2365114 (- strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_113:2365050..2364994 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_113:2364928..2364574 (- strand)
Length: 355
Type: CDS
Source: GLEAN
Position: GCSC_113:2364517..2364278 (- strand)
Length: 240
>GLEAN_7895 class=GenePrediction position=GCSC_113:2365802..2364278 (- strand)
ATGGCTGAAGATACTGTTGAACAGGGCCTGGTGCAGGTGGACAGCGTGAGTAGATACAGCCTTTCTGCGAGCACTCATTC
TACCCTTAGTGCAATCTTTAGTCACACACACTAAAATCACCTAGATTCGCGACGATGATCCAGGCTACGACGATGGTGCT
TCGTAGGTCCCGGAACCGGTAGACTCGTTTCATTATGAAGAGGTCTGACCAGCCCCTTAGGAACGCCTCCGGCAGCTTTG
TTTCGTCCCTGAACTCAAGCATCTTAAACTACAAGCAAGCTTTTCTTCCTCTGTCGTGGGGCAGGGGCATAGGATAAGAC
TTGACGCTGACTGATTTACAGATACGAGGTTTGTTCCGGGAAAAAAGGATCTTGCAGAGTACTTCGTACTCGTCAAGGTG
TTAATGTCAAGCTCTACGGGATAGAACGGGCGTCGCTACCATGCATTTCGAGAGGGTTCCTATCTGATCGTACGTTATCA
CGACATGGCCCTTCTGATGACCACGTCCGTTCTTAACACGCAGCGTGACAGCCTAACGACAACGAAGAGCAAGAGCGGAT
GGACCTAGTCCACCATATTTACCGACTGCTGCTGAAGGGCGCCCTCCATCTCGCTCCTATCAGCGAACATCCCCAGCGCG
TTCTTGATCTAGGCACAGGAACTGGTATTTGGGCTCTAGAGTTTGCCGAGTTAGACACCCTGTTCTGTAAAACTCCAACT
ACGCTACTAACTAATAATCTGTTTTTATTTAGCGAATATCCCTCGGCTGAAGTACTTGGCTCGGATTTAAGCCCTATTCA
GCCACAGTGGTATGTTGGTCCAGCGACGCTTATTCTTATAAGATATCTTTTATAAACGACTTACTCTTGGATAGGACCGC
CCCTAACTGCAGCTTCGAGGTTGACGACTTTGAAGATAATTGGACCTACAACAGAAAGTTTGATTACATCCACACCCGCG
AGATTGGAGGCTCTGTTGCCGATATCGACAAGCTTATACAGCGCGCATACGAGCATTTAGCCCCGGGCGGGTACTTTGAG
ATTCAAACCTCCGTGTCGAGATTTGTATCCGATGATGGCTCGGATAAGAAAGCACCACATTCTGTCAAGTGGGCGTCACT
TATTACTGAGGCACTGTCAAGGTTTGGAAAGCCTTGTGACACGGCCCCAGAGTACAAGGACAAAATAAACGCGGCTGGCT
TTGTTGATGTCCAGCAGGATATCCGCAAGGTTCGTTTCTTCTGTCTAAGTCTGTTAACTAAATATGCTTGCTAACATCCA
GTTAGCTGCCCATTGGTGCCTGGCCAAAGGATCCAGCTCTGAAGACCATTGGCAGATACCAGGTTGTTCAGCAGACACAG
GCCGTTGACTCGTATACGCCGGGTATTTTGTCCAACGTACTTAACTGGAAGGACGATGAAATCCAGGTGCTTGTTGCCAA
GGCGAAGAAGGATCTTAAGAACCCAGAAGCCCATCTTTACCTTCCTGTCTACTTTATTTGGGGCAGAAAACCGCTTGCAG
CATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62