GenePrediction:GLEAN_7896 Details

Name: GLEAN_7896
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2363483..2361995 (- strand)
Length: 1489
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2363483..2363333 (- strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_113:2363237..2362993 (- strand)
Length: 245
Type: CDS
Source: GLEAN
Position: GCSC_113:2362921..2361995 (- strand)
Length: 927
>GLEAN_7896 class=GenePrediction position=GCSC_113:2363483..2361995 (- strand)
ATGGCTCCGATCAGACCGCCAATTTACTCGCAGGCTGTGCGCTTCGTTCTCGATGTCGCCAACCGCCGCAGTCCGTTGTC
CAAGCTTGTTCCTGTGGCTCTGCTGGCGCTGGACGCCGTCCTCTGCTGTCTGATCATATGGAAGATCCCGTGTAGGTTGC
CCATACAGCTACCCTCCCTTCCTATTCACTATTCCTCGCACTCCCCCTGGCTCCGGAACCTGCTGACCAGTTGTACTCAC
GAGTAGACACCGAAATCGATTGGGTCGCATACATGGAGCAGGTCGGCCAGTTTGTCGCCGGCGAGCGCGACTACACTCAG
ATGAAGGGCGGCACCGGCCCATTGGTCTATCCGGGCGCCCATGTGTACACATATTCGGTGCTATACTACCTCACCGACCA
AGGCAGCAACATCTTGCTGGCCCAGCAGATATTTGCGGGCTTGTACTTGTTCACACTGGCCGTCGTCATGCGTTGCTACT
GGCAGGCAGGAGTGCGTTTGTTTCTTGTTTTCTCTCTCTTCTTTCTTCTGCTCACATGGCTAACCTTCTCGTCGACACGC
AGGCTCCCCCATACGTCCTTCCGCTGCTTGTGCTATCGAAGCGGCTCCACAGCATCTACATACTCCGCTGCTTTAATGAC
GGCTTCGCCGCCCTCTTCCTCTGGCTCGCCATTCTCCTGCTGCAGCAGAAGCGCTGGACGCTCGGCGCGCTCGCCTACTC
CTGGGGCCTCGGCATCAAGATGAGCCTACTGCTCGGCCTGCCGGCCGTCGGTGTGGTGCTGTTCCTTGGCCGTGGTTTTG
TCGGCGCTCTGCGCGCTGCCTGCCTCATGGCCCAGCTGCAGATCGCTCTCGCGGTGCCGTTTCTGGCCGCAAACCCGGCC
GGCTATCTTGGCCGTGCTTTTGAGCTGTCGCGCCAATTCTTCTTCCGCTGGACCGTCAACTGGCGCTTCGTCGGCGAGGC
CCGCTTCCTCAGTCGCCCCTTTGCCTTCGGTCTGCTCGCCCTGCATGCCGCCCTGCTCGCCGTCTTTGCCACCACCCGCT
GGCTGCGCCCGACTGGCCGCTCACCCGCATCGCTCGTCCACACCGTGCTAGCCTCCCGCCGGCTGCCCTTTACCGACCGC
GAAGAGCGCCTGCTCGCGCGCTCGGCTGCCTCGCCGCGCTACATCGCCACCACCGTACTGACAGCCAATGTCGTCGGCTT
GCTAGCTGCCCGATCGCTGCACTACCAGTTCTATGCCTACCTCGCCTGGGCCACGCCGTACCTCCTGTGGCGCTCCGGCG
CCCATCCCCTCGTGCAGTACGGCCTCTGGGCCCTGCAGGAATGGGCCTGGAACGTCTTCCCCAGCACGCCGCTCAGCTCA
GCCGTCGTCGTCGGCATCCTGGCTGTCACGGTCGCGCTAACCTGGTGGGGCGCCACTGATGAGTACCGACAGGTGCTGCC
GCTCGAAAAGGATGAGGCCGTCAAGAGGAAAAAGTCTGCGGAGATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62