GenePrediction:GLEAN_7897 Details

Name: GLEAN_7897
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2360418..2358435 (- strand)
Length: 1984
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2360418..2359967 (- strand)
Length: 452
Type: CDS
Source: GLEAN
Position: GCSC_113:2359911..2358435 (- strand)
Length: 1477
>GLEAN_7897 class=GenePrediction position=GCSC_113:2360418..2358435 (- strand)
ATGATGCACCAGCTTATCAGCATCGAGTCCTCGTCGGCTCCAGCTCTGGAAACGACGTCGACGTCGACAGATACCCGTCA
ATTCGATGTCCCTACACGGCCGGCTAAGGCCATCTCCCGCATATACGCAGCCGTGCCGCTGAAGGAGTCCAGCGCCAGAG
AGTATGAGCAGCGCAGCAATCGGGAGGCCTTTGATGCCAGCGACCTCGAGCGCAGTCGTCCGGTGACGCCTACCGGACTG
GGAGATATCGAAGATGACGATCCCGGCAGCCCAGGCAGCCCCGGCCGTAACGGCAACGGCTTGAGCGGCGACGAGGCCGA
TGGAGTGGAGGCCCTGCAGAGCATCTGGGATCCGTACATGAATCGCTTCCGTCTGGCGACCATCTCGCTCATCAACTTTG
CCAACGGGCTGAACGACAGTGCCGCCGGTGCTGTTCTCCCCTACATTGAGAGGTAGCTGCCAGTCTCCTTCCTGTACGCG
ATATGTCGAAGCTGACTCGACTTTCAGGCACTTTGGCATTGGCTATGCGATTGTGTCGCTCATTTTCGTTGGCCTCGCCC
TTGGCTCTATCATGGCTGCGCCCGTTGTGGATTTAATCCGTCGTCGCCTCGGACGTGGCCGCACGCTTGTCTTCTCGCAG
CTGCTCATGGCTGCCGGCTGCATCCCCATCCTCACGACGAAGGCGCCGTTCCCGGCCATCGTCATCGGCTACTTCGCTGT
CGGTTTTGGCGAGGCCCTCAACCTGGCCATGGGCAACACCTTCTGCGCGAACCTGCGCCAGACCACCGTCGCCCTTGGCC
TGATGCACGGTTCATACGGCATCGGCGGCATTTCTGGCCCTCTTATTGCCACTGCCCTGGCCGTGGCCTCCGGAGCGGCC
GCCAATCCGGACAACAAGACTGCAGCCGCCTACTCGTATTACTACTTTGTGCCGTGTGGCATCATGTTATTTACAGCCGT
TGCCGCTGGCTGGAGCTTCGCGGGCTACGAGAAGGACGACAATAATCAAGTTGGTGCGGCCTTGGAACTGTCCAACGCTG
GTGTGCTGACGGAGTCTCCGTCTTTGTCTCAGCAGCGGCAGCAACGGACTCTCGGCCGGAACTGGCGCGGACATTCACGC
GCTGCCTCGCAGGCAGCCTCACGAGCCCCGTCGCCTGAGTCACTGTCCCTCGTACCGACATCCTCGCGGCCTGCGCCGAC
ACCGCTGCAGGCGTCCACGGTCAACCCGACGCCGGCCATGTCATACTCATCCACCACACGGTTCATGACAGAACCTGTCG
GCCGCGCGTGCACCCCGATTCCCGCTGCAGCCGCCATCTCTGCTGCTGCTAATTCTGCCAATGGATCGACGCGCGCTCGG
CAACGGCCACAGCGTCCACATATGTCTCCCTTCTTGGCAGTGTTCTCGGCGCGCATGTCCCGAGTTGTCCTTCTGGGCGC
GTTGTTCATCATGTGCTACCAGGGCGCCGAAGTGTCGATTGCCGGCTGGGTGACATCGTTCCTAATTGCCGATCGTGGTG
GTCACGAGCCCAACGTCGGCTATGTCACGTCTGGTTTCTGGGGTGGCATCACGCTCGGTCGGTTCCTGTTGGCCGGGCCT
GCCCACCTGATTGGCGAGCGTCGTGCTGTGTATCTTTGTGTTGTCGGCTCGGCTATATTCGAGCTTCTGGTGTGGTTCGT
TCCCAACGTCATCGGGGATGCCGTTGCCGTTGCCATTGTCGGCCTGCTGTTGGGACCCGTCTACCCGTGTGCGGCCGCGG
TTCTGATGCGCAGCATGAACCACCGCGAGCGCGTGACTGGCATCGGCATCACAGCTGCGTTTGGTAGTGCTGGCGGTGCT
GCGGCGCCCTTCATCACAGGCGTGCTGGCCCAAGCGGTTGGCACGTTCGTGCTGCATCCCATAGCCCTGGCGTTGTTCGC
CTTTATGATTGTGTTTTGGTACAATGTGCCGGTATTGCGGAAGCCGACTGAGTTAAAACTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62