GenePrediction:GLEAN_7898 Details

Name: GLEAN_7898
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2352385..2351278 (- strand)
Length: 1108
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2352385..2351890 (- strand)
Length: 496
Type: CDS
Source: GLEAN
Position: GCSC_113:2351681..2351278 (- strand)
Length: 404
>GLEAN_7898 class=GenePrediction position=GCSC_113:2352385..2351278 (- strand)
ATGGACACATCGGATGTAACGTTCAATAACGAACATGACTCTGGGGAGAGCGGCGACTCTGGGGAGAGTGACGACTCTGT
GGGGAGCGACGACTCTAGGGAGAGTGACGACTCTGGGGAGAGCGACGAGATGGACGAGTCAGATATGCTGTATCACGAGC
AGCCATTGAAGTGCGATACGCTGTGGAACCCCGCTTCGCGGCGAGACTTGACGATTCACATGGAGCTGGAAGTTGAAAGC
GACATTAAAGGAAGCCTCCAAAAAGCAGCATATCTCAGACGCCTCGGCCACTTCCAGCAAGCAGACTGCTACTTTCGGGA
AAATCTCGCAGATTTTTTTGACACCCCACTGGTGGTGCTAGAATATGCCGACTTGCTGCTCGCACAGGGCGACTACAGGC
GTGTTCTCGAGACGTTTGCCGTGGATGAGTTTGTGCCGGACAGTGAAGCGTCCATCATGTCTGCCCTGAGCCTGCAGCTA
TCCCGGTGCAATAGAAGTCCAGATCTACGCTTGGCCTGTCAAATAGCCACGGTTTCCTTGGCTTATTTGAACAAGATGAA
GACGGCAGATAACTCTGTTTCTCCCCCCCTCAGACAAAGCCAACATGTCAGCTACAAATTCTGTGCAAGACTTTCACGCT
GATCAGTCTTGTCCATGAATATACTTGAGCCTCTTTCATTACACGGATTTTAAATTGTCTCAAGCCCTGCGGATGTTTTC
TGGCATCTACAAGACTCTCCTACGGGAGAGTCGCTACTGGGAACTTCGAGATATCTTTCATGCACTCCTCGAAGTATCGG
AGATAGAGCAGACATGCCGCGCCCTGATGGACACCAAGACGGCCATGGCCGGCGTGTCCAAGCTTGTGGCTGACTGGCAG
GCTACGGCGCCCGACCAGGCTGCACAGCTCTGTCTCTTGCAGGTGCTTGTCAGTTTTAGTCGCCCTTGTGTGCAAAAGCA
CGCAAACGACAGCAGCCTCGCGAGCCTGACAGGATTCATCTTTGACCAGGCCAGGGAGATTGCAAGCGCGACCAGGGACA
GAAGAACAGAGAACACAAATTGCCGGGCCTATCTCGACTGGATTCTGACCGAGGAAGAATATGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62