GenePrediction:GLEAN_789 Details

Name: GLEAN_789
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2134540..2135300 (+ strand)
Length: 761
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2134540..2134924 (+ strand)
Length: 385
Type: CDS
Source: GLEAN
Position: GCSC_97:2135198..2135209 (+ strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_97:2135296..2135300 (+ strand)
Length: 5
>GLEAN_789 class=GenePrediction position=GCSC_97:2134540..2135300 (+ strand)
ATGCACCCACCAGTTGGTGGGATGCAAGGCTACAACGGGATTTACTGGGGTTGGAACCCCGACATCGATAACGGGGTGAA
CATCAGCATGATTAACGAGGCCACCGGAAAACAGGCGAGCACCTTTGGCATATTCAGTCAAATTAAAAATGCAAGCTCTT
ACGATGGACACCAGTTGTTGAAGCACATCAACGAAATCAAAAGCAGCGGTGCAGTGCTTATCGCAAGTATCATGCCTACA
GGGCTGAAGTTTAGCGAAGTCGGCCCTGCCATCGCGAAGGATATCGCCACGGTGGTGAAACAGTTTACTGATGCGAAAGT
GGAGGTTTGGGTTCGTTTCGCACACGAGATGAATTATTATGCCGGAACGGGATATTACAATGGCAGTACGTGAATCTGAG
CGAGTCTTTAGTGCGGAAGGTATTCGCCGACACTCGACTGACAATACATTTGACACGACAGCAGCGGAGGAATTTATACA
TGCATGGCGCAATGTTTCTGATGCTCTTAAAGACATTGATCGCTGTTTGATGTTCTGGTCACCAAACAACGCGAAGACGG
TTGATGAGATTAGGCAGTGGTGGCCCGGCAGTGAATATGTTAATATAGTTGGCGTGGATCAGTATGTTTCGAGTACTAAA
GCTACTTTCGCAAATCAGTTCGGCTCTTTCGTCAGTTTTTACCATTTATTATATCTTCTCTTGAGCTTTCCGCTGTAGCG
TTGTCTTATTCTTGCTAACTTTTGTCGCACTGACAGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62