GenePrediction:GLEAN_78 Details

Name: GLEAN_78
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:507327..507681 (+ strand)
Length: 355
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:507327..507385 (+ strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_179:507462..507681 (+ strand)
Length: 220
>GLEAN_78 class=GenePrediction position=GCSC_179:507327..507681 (+ strand)
ATGTCGTCCCCTGATCCCTGCTACGTTGTTTCTGATTCGAGCATGGGCGACAGCGAGGAGTAAGTACATCCGGATACTTG
CACGATACGGTGTAGCTGGAATGAAGAGCAGCCGCATTGCATTATGCATGAGTAGGCGGACCGGCATCGTAGCATCGGAC
GAAGCAGACACAGGAGACCGGGCAGACAACAATGCCGTTGTGAACTCTCGTATCCTCCTACAGGTCACGTTGGAGGTCCT
GATGCGGGTGCATCTGGCAGTAGCGGTGGCCGCCATGCCCGAGCAGGCGGCCGACACGCTGCTCCGTCTTCGTGTGCTGT
CTTCTGAGAGGCGAGCATTGGCACTGTCGACCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62