GenePrediction:GLEAN_7901 Details

Name: GLEAN_7901
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2336372..2334680 (- strand)
Length: 1693
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2336372..2336160 (- strand)
Length: 213
Type: CDS
Source: GLEAN
Position: GCSC_113:2336096..2336045 (- strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_113:2335983..2335664 (- strand)
Length: 320
Type: CDS
Source: GLEAN
Position: GCSC_113:2335606..2335085 (- strand)
Length: 522
Type: CDS
Source: GLEAN
Position: GCSC_113:2335030..2334680 (- strand)
Length: 351
>GLEAN_7901 class=GenePrediction position=GCSC_113:2336372..2334680 (- strand)
ATGATTTCCCCTGCATACCTTTCCGTGGTGGCTGCACTTGCATCGTGCTGCGGCGCGTTTTCCAACTGCAGCTTCGGTGC
GCAGTATGCCAACGCCTCATACAAATCGGTAGATGTCGTGATTGTTGGGGGCGGCTCGTCGGGCTCCAACGCAGCCGTGC
ATCTGAAGGATGCCGGCCTGGACGTGCTAGTGGTCGAGAAGAACACCCAGCTGGTATGTCGCTGTACTAGGACGGTGTTT
TGGCCGTCTATGAACTGACACCACTTTCTCCTCTAGGGTGGTATGGTCAACAGCTGGACCGATCCTAGCACCGGCACTGT
CTATGACTGTATGTTTTCTTTCCGTTTCAGAGCATTGGATTTCCCCTTTCCTACAGCTAACGCGAACAGACGGTGTGGCG
GCCTACACCAACTACACCGGTACATTAGACTTCTTTGCGCGGCTCGGCATCAATGTGACGACGGCGTCGTCGCTGGCGGT
CGAGTCAACGTACGTCGACATGAGCACGGGCTTGGCGATCAACTACACGGCTCCGTCCCTGACGGACGAGGTGGTGGCGC
TGGAGAAGTATTACAACATCTCGTCGCAGTACGCGGATCTCTACCTGCCGTCGTATGCCAACTGGCCTGCACCGACCGAC
ATACCCGAGGACCTCCTACTGCCGTTCCGCGACTTTGCCCAGAAGTACGACCTTGACGCGGCTCTGTTTGTAAGACTCGC
CTACGCGTTGACCTCTCTCGCCTACAGAAGCTAACCTGCCGCACAGCTGCTGTGGTGGACGATCGTGTCGGGTTTGGGCA
ACATGCTGGACGCGCCGACGCTGTACGTGTTCCAGACGTTTGGCCCGACGACAGCGGCGGCATTCCTGGGCGAGGCGCCC
GAGTGGGTGCCGGAATCGAGGCGCAATCAGGACATCTACGACAAGATCGCGGAGATCCTGGGCGCACCGGCAGTGATGAC
CAACAGCCTGGTGGTGTCGGCGCAGCGGCTGGCAGACAACGACGGCGTCACGCTAGTGGTCGAGGACCAGACGACCATGG
CATACACGATTGTCAACGCAAAGCGACTGGTGATGGCCATCGAGCCGACGGCATCCAACGTGGAGCCGTTTGACATGGAC
ACCAAGGAGACGGCTGTGTTTGCCAAGGGCAACTGGAGCGCGGTCAACACGGGCATCATCACGCACCCGTCGCTGCCGGT
CGACGGCCAGATCAACAACCTGCCGGCTGCAGCGGAGAACGGCAACTACTATGCGTACCCGACGGTGCCGTTTGTCGACT
ACTTTTCGGTGAGATCGGTTTCTCTCTTTCTTTCCCCCCCCCTCTCCTCGCTAACGGTCTAGTACATTGGCGACAACCGG
TGGCAGGTGATTGTCGGCAGCTGGTATGGAATCACAGACGTCGAGGCGCAGGCGATTGCCAGCGAGGCCATTGAGAAGAT
GGCAGCTGCAGGCACGATCCCGGCGACCAACGGCACCAAGATGGAGGTGCTATCGTGGTCTAATCACGGGGCCATGGACA
TGCGAGTGACGGCGGACGACCTTAAGGCTGGCTACATCCAGGAGCAGTACTCGCTGCAGGGATACCGGTCGACGTACTGG
ACGGGCGCAGCCTTCTCCAGTCAGCTGTCGACGTTTCTCTGGGCCTATAATGAGCAGTACCTAGTGCCGCTCGTAGCGAC
TGACCTTACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62