GenePrediction:GLEAN_7903 Details

Name: GLEAN_7903
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2324508..2323628 (- strand)
Length: 881
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2324508..2324014 (- strand)
Length: 495
Type: CDS
Source: GLEAN
Position: GCSC_113:2323915..2323628 (- strand)
Length: 288
>GLEAN_7903 class=GenePrediction position=GCSC_113:2324508..2323628 (- strand)
ATGGGCTCCCATCCAGAAAAGCCTCTCCGGCTTGCCATCCTCATGGCCGATACCCCCATGCCACAAACCCAGGCCGCCTT
TGAGGACTACGGTGGCGTCTTCACCGACCTCTTCCGCCGTGCCCTCGCTCCCGCCTCGCTCGACTCCGTCCTAACCATCT
CCAAGCACGACATCGTCAACGGCGACTTTGCAGCCGCCTATCCCGACCTCAACCAGATTGACGCCATCCTGATCACCGGG
TCCAAGCATAATGCCTACGACCACACGCCCTGGATCAATGCGCTCGTCGCCTTCGTGCGCCGCGTTCTCGCCACCACCGC
CCCGGGATCCACGGCTGCCCATCCCGTTCGCCTGCTCGGCATATGCTTCGGTCACCAGATCTGCGGCCGTGCCCTCGACG
CTCCTGTCGATGTCAGTCCGGCCGGTTGGGAGGTCAGTGTGACGGACGTACCGCTGACGTCCGAGGGACGCGCATTCTTT
GGCAAGGATACGTTGGTGAGTAGAGTAGACAGAACAGAGACACCCAGAGCAGACCCAAAAACAGACCCAAGACAGACACA
GCAACAGACACGACACAAACTCACAAACCACAGAACATCTTCCAGATGCACCGCGATGCCGTGCTCGCCAACCCCTCTGG
CACCATCGCCCTCGGCGCTACCGACTCCTGTCCCGTCCAGGGCTTCTTGCTGCCCGGCCGCGCCGTCACCGTTCAGGGCC
ACCCCGAGTTCTCGGCCACCATCGTTCGCGAGATCCTCGACAAGCGCCACCAGATCGGTATCCTTCCCGACGACCTCTAC
AGCTCCGGCATCGCTCGTGTCGACAACAAGCACGACGGCGAGCTCATCGCCCGCGCTTTCGTCACATTCTTGCAGTCTTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62