GenePrediction:GLEAN_7904 Details

Name: GLEAN_7904
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2321902..2321216 (- strand)
Length: 687
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2321902..2321891 (- strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_113:2321797..2321751 (- strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_113:2321605..2321552 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_113:2321493..2321400 (- strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_113:2321340..2321287 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_113:2321224..2321216 (- strand)
Length: 9
>GLEAN_7904 class=GenePrediction position=GCSC_113:2321902..2321216 (- strand)
ATGCCGTTCGCCGTATGTATCCTCATCCGGGCCTGAGCCCGACCCTGCAAGCCCTGCGCTGCCGAATGTGGATTGCGCCC
AGCTTGCTGACACTGTCACTGCTAGACTCCCATCATGCGGTCCTCTTCGTACAAGAGCCTTTACGGCCCGAAGTAAGCGA
ATTCCCTACGTCCCCGTTGACCAACTCATCCGCTGCCCCACCCCGAGCTGGACAAACAGCCGATTCGCGATTGGACGCAT
CGGGGCAGCCGTTTGTTCCCCTCTGGACGTCGACTGACTTGCGACTCTCCTCTCCAGGTACCACAGCCAGCCGAACTACA
AGGGCATCACCTCGAAGCAGGTCGTCCGTTTGTGAGTTTTCTCTACGAAGCGCACGCCATTGCCAGCTTCCTCCTGACAC
GCATGACAGTGGCATCCAGACCGGCCCCTTTGCCGTTGCCGCCGCCGTCGCTGCCCTCTTCTACACCTCCGGCATCCCGC
GGATACAGACCGACATCCTCCAGGTAAGGACACATGGCCGAGAATGAGACAGACAAGCAATGGGATGCTAACAGCCGAAT
AGAAGATCCCTGTGGTGGGCAGCTACTTCACCAAGGAAGTCAACCCGGCCGACTCTGTAAGTAGAGCCTCTCCAGCTGCG
CTCTTTCCTCTAACGACGACCTAACTTTCATCCAACAGCCCTTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62