GenePrediction:GLEAN_7905 Details

Name: GLEAN_7905
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2320849..2318322 (- strand)
Length: 2528
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2320849..2320538 (- strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_113:2320483..2320395 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_113:2320329..2318322 (- strand)
Length: 2008
>GLEAN_7905 class=GenePrediction position=GCSC_113:2320849..2318322 (- strand)
ATGAGCACCGGTAATGGCGGCCGTGCCGTCGAAGACGCCCGGCTGAAGCCGTTCCTGGCCTCGTCCATCTTCGTCGTGCC
CTGGATCTCCTGGCAGGCCTGGGTCCTGGGCGTGACCTTTCGGCAGAGACGCGGCAAGCTCGTGGCCGACAAGGTCGGCG
GTGCATCCACCACAGAGACCGCTCCTGGAGCTCCATCGCCCCGCCAGCGACCATGGCGGCCGGTCATCTTCGTCATGGGC
GTCTCGCTGCTCTTCATCGCCGCCCAGGCCTGGCTTCGCGGCGTGCTGGTCTACGTGCCCGAGCCGTACCTGGTGAGAGC
TCCTGTTCGTCCTGTCTGAAATCAGCATTCCAACCCGGCTCTGCAGGATGAGGTGTTTCATATCCCCCAGGCTCAAAAGT
ACTGCCACGGCCGGTGGCTCGAGTGGGACGACAAGATCACCACGCCTCCTGGACTGTATGTCTTTCGCTCCTTGCACCTT
TACTTTTTCTCCTCTCCCAGCCTCTCCTGACAGCAAACAGCTATCTCTTTTCGGTGCTCTACCAGGGCTTTTGGAAGGCC
GTGGACGGGTCTTCGGTCTGGGCCCTCCGCGGCGCCAACAACATTGCCATCATGCTCGTAGCCATTGCGGCCTGCTCCTG
TCGCTCCGAGCTAGAGCACCAGGAGCAGCAGCGGCTCGAGATGGTGATGACAGCCAGCCGCACTTCCACCACGTCGTCAC
ATCGACCGCGCAAGCTCGCCGACAGCATGTTCTCGCTGTACGCCTTCCACACCGCCCTCAACCTCGCCCTCTTTCCCGTC
CTCTTCTTCTTCTCGGCCCTCTACTACACCGACGTCTACTCAACCCTCGTCACGCTCGTGGCCTATCGCGTCCACCTGTT
TCGCCGCCAGTTTGCTACCGTCCCCCAGCCCGTCTCCCCGCCGCTCTGGAGTGGCCTCCTGGCCGTCCTGCTCGGCCTCG
TCACCCTGCTCATGCGCCAGACCAACGTCTTCTGGGTCGTCGTCTACATGGGCGGCCTCGAGGCCGTTCAGGCCATCAAG
AGCCTGCGGCTCCGACCCCAGGTCCCACAGCCTCCGCTAGACGAGGCTGTCTTCGCTTCGCCTATAGCCATAGCTTCGCA
CTACGCTCAGCAATATACCCTCGGCGACATCCACGACCCGCCCATTGGCGAGTCCTGGCCTGATGGTCGGTTTTTCCTCG
TCTTTTTCTTCGTCTTCTTCCTCTCCTTTCTGGCCGTCTCTCTTGCTGACTCAGCAGACTGGGTCCTGACTCTGCTAAGT
GTCGGCATCGCCGTCCTCTGCAACCCGCTCCGCATACTGCGGCACGTGTGGCCATCGATGCTTGTCCTGGGCCTTTTTGC
CGGCTTCGTCGCCTGGAACGGAGGCGTGGTGCTGGGCGACAAGTCCAACCACGTGGCTACGCTGCATCTCGCACAACTGC
TCTACATCTGGCCGCTATTTGCCTTCTTCTCAGCGCCGCTCTTTGTGTCCCATGCGGTCGCTTACGCCCATCATGCGTGG
GCTGTCGCCACTGGTGCGACAACGCAACAGACGGATAAGGACGAGAGCCGGGACGGTCTCGTCGCAGCGGCTGCAGCCTC
GGCCACCCAGACCGGCAGCCCAGCCATGCGTCTGCTGTCGGTCGTCTTTGTCCGAAAGGCTTACTATCCCGCGTACCTCT
TGGCCGTGCTGGTCGCCATGCTCGCCATCGTCCGCTACAACACCATCGTGCACCCGTTCACCCTCGCCGACAATCGCCAC
TATATGTTCTACGTGTTCCGATATACCATCCGGCGGGCGGGCTGGCTCCGCTTTGCGCTCGTGCCCGTGTATGCAGCGAC
TAGCTGGGCCTGCTGGCGTGTTCTCTGGGGCTGCAGTGCGTCCGGTCGCCTCGGTGGATCAGGGAACGCGTGCTCTGTCA
GCTCACCGTTTTCAAGACCGGCGCCGCAATCAGTTGAGCCGGCTCCTCTGCCGACGGCCAGTGATGAAGACAAGGGGAAC
GAGAAAGCAGCACCGCGTTCAACAAAAAAGATCAAGCAAAAGCTGGCAGCAGACCGAAAGGCACAACAGGCTAGCAAGAA
GGCGGCGGCAGAAACGGCAGACGCTGACGACAGCACTTCTGCCACCGACCTCGACGAGCAACATCCAGTATTTGTCAGCC
TCCTCGACGAGGAGCCGGCAGCAAGTGCAGCAATGACGCCACCAGCAACATCGACAGCGCTGCTGTGGCTCCTGGCTTCA
GCTCTATCGCTGGTGACGGCACCGCTGGTCGAGCCGCGGTATTTCATCCTGCCGTGGGTCTTCTGGCGGCTGCTGGTTCC
GGCTGTTCCCATTGTAGCCTCGCCCAAGACAGCCGGTTTCCTCGCCTCTCTGGGACGCAAGGTAGACGGGCGGCTCGCCC
TCGAGACACTCTGGTTCCTGGCCATCAACGTGGCCACAATGTACATGTTCCTGTTCCGTCCGTATGTCTGGCGGGCAGAG
GATGGCAGCCTACTCGATCATGGACGATTGCAGCGCTTCATGTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62