GenePrediction:GLEAN_7906 Details

Name: GLEAN_7906
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2311508..2308131 (- strand)
Length: 3378
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2311508..2310935 (- strand)
Length: 574
Type: CDS
Source: GLEAN
Position: GCSC_113:2310864..2310146 (- strand)
Length: 719
Type: CDS
Source: GLEAN
Position: GCSC_113:2310065..2309485 (- strand)
Length: 581
Type: CDS
Source: GLEAN
Position: GCSC_113:2309224..2308936 (- strand)
Length: 289
Type: CDS
Source: GLEAN
Position: GCSC_113:2308883..2308131 (- strand)
Length: 753
>GLEAN_7906 class=GenePrediction position=GCSC_113:2311508..2308131 (- strand)
ATGGCTACACGATGGAACAGACGGCGACTGGTCGCTACATTCGTCGTCATTGGCGTCATCAGCTTGCTGTACTTGCAGCA
CGATTCCGGAGCCCTGGCGCCTTGGGACGTGCCGCCCAGCGACATTCGACCTCCGGGACCGCCTATCCCGCCCACCCAAG
AGCAACCGGCGCCGACTCCATACGTCCCCGGGCCACCCACGCCGCCACCGCTAGCACCTCCACCTTCGCCTCCCGCACAA
GCAGCCTCACCACCGCCAGTCGTCAGCTCTGGCAAGTTTCACTGGTCGACCCTGAAGCTGCACTATCCTATCGCGCCCGA
GCAAATTAAGCCGCTGCCGTCGGCTAGCCCGGAGATGCTGCGGGCGATCCCCAAGATCCAGTACGAGTTCGGGGCCGAGA
CGGCGGAGGCGAAGCGGGTGCGGCTGGAGCGGCTGGCGTACGTCAAGGCCAACTTTACGCATGCCTGGACGGGCTACAAG
ACGCAGGCCTGGCTGAAGGACGAGGTGCGCCCGATCAAAGGCGGGGGCGTCGAGCGGTTCGGCGGCTGGGCCGCCACGCT
GGTGGACTCTCTGGGTATGTCTTGCGTGACGCGCCCAATCTGGCTGCTTTTCTCGATGGCTGACTGTCTGTCCATCGCGC
ACAGATACGCTGTGGATCATGGGCTTGACGTCCGAGTTCGAAGAGGCCGTCGCGGCTATTGACAAGATTGACTTTACAAC
GTCTACTGAGGAGGAGGTGAACGTGTTTGAGACGACGATCCGATACTTGGGCGGGTTCCTGGCTGCATATGACCTGTCGG
GGGGCAAGTACCCGTCGCTGTTGCAAAAGGCAGTGGAGCTGGGCGACATGCTGTACGTGGCGTTTGACACGCCCAACCAC
GTGCCGATTGCGCGGTGGAAGTACGGCGAGGCACGCAAGGGCGTGTCGCAGAAGGCGTCCCGGATGGCGCTGGTGTCGGA
ACCGGGCTCACTGTCGATGGAGTTCACGCGGCTGAGTCAGCTGTCGGGCAATGCCAAGTACTACGACGCGGTGCAGCGGG
TGATGGACCTGTTTGCCGACCAGCAGGACCGCACCTTTATTCCGGGGCTGTGGCCGGTGACGGTCAACACGGAGCAGGGC
GACTTTACGGGAGGGTCTGGGTTCACGATTGGCGGCATGGCTGACTCGCTCTACGAGTATCTGCCCAAGGAACACCTCAT
GCTCGGCGGGGCCAGCGACCAGTACCGCACGATGTACCTTAAGGCGCTCGCGGCGATGGATGCGAACCTGTTCTTCCGGC
CGCGGACCAAGTCGGCGCGGCCGATGCTCTTCCCGGGCGACAAGACGGTGGGCAGGAACATTGTGGCGGCGCAGGTGGCG
ACGGTGCCGCGGGTGCAGCACCTGAGCTGTTTTGCCGGCGGCATGGTCGGGCTGGGGTCGGCGGGCTGTTTGGGCGGCCG
GAGGACATGGAGACGGCGCGGCAGCTGGTCGAGGGCTGTCTGTGGGGATACGAGAACGCGCCGAACGGGATCATGCCGGA
GATCATGGAGGTGTCGCCGTGTCCGCGGGCCGAGGCCGAGTGCGTGTGGAGCGACAAGGACTGGTACGGCGACGTGCGGC
GGAAGAGTCGGCTGGCATCGACGACCAAGGACAAGGACGGCGCAGTGGACGTAGCAGCCATCGTCGAGGCCGAGAACCTG
CGGCCGGGCATAGCCCGCTACGACGACACGCGCTACATCCTGCGGCCAGAGGCGATTGAGAGCATCTTTGTGCTGTACCG
GCTGACGGGCGAGGCCACGCTTCTGGACCGGGCGTGGGCCATGTTCGAGGCTATCGTGCGGACGACGACGACGCCGATCG
CGCACGCGGCACTCAAGGACTGCACGCAGACGGATCCGCGCGCTAGCATGGTCGACAGCATGGAGAGCTTCTGGCTGGCC
GAGACGCTCAAGTACTTTTACCTGCTGTACGCGTCGCCGGACCTGGTCAGCCTGGACGAGTACGTGCTGAACACGGAGGC
ACACCCGCTGCGGCGGCCGAGAGCGTGAGGTGGGGGGTGTGGAACAGAGGATGAAGGCCGAGATACATATGAGAAGTACA
GAGATAAAGAAGAGGAATAGGAACGAAGGCCACGTGGCAGAGTCGTCGATCGGGATGTCTATTGCCCTCGCCTGGCGTTG
GAATCTATGAGCATTGTATGTCTTGACCGCACTCTGCTCCGTGTCGGACAGCGGACGGAAGTATCGAGGCTGTGAGATAG
TTCACAAAGTACGGAGTAGACCAAAGTCACAAGCACGGGAACAGGCGAAGCTACAAACAGCGTACAGCCACCAACCACCG
CCACCCACCCGCCCACAGCCAGCCACACGCCACGCCAACCCCGCCAAGATGGACGCGACGCGACGTTTTCCAATGGACAT
TGTCCCCATCTGCTCATCTGCTCACGCTTTTTCTTCACCACGCCGTCATCCTCGCTGCCATGGCTCTCCCGCTGCCGCCG
GGCATCACGCCCGCCGAGGTGTCGTTTCTCTGCGAGATGGAGCTCGTCACAGTCGTCCCGCGTCAGCGTCTCGACCCGAT
CCATCTGTTGGGAGTAGGTTCTCGTCTCTCCTTCCATCCTCCTCCTCGCCTGTGCTGACTGCCAGGGCGACACCCCTCCC
CTGCGCCCACCTCACCGTGCCGTCTTGCCGCTCTGGCTGGCCCTCCTGCTGAAGCGCCAGCGTCGTGCTAGCATCGTCGC
CCCGCCCTGGCTGCACCCGTCCAGCCTGCAGGAGCTGGTGCGAATCGAGACAGTCGGCAGCAGCAGCAGCAACAACAACA
ACAACAACAACAACAGCGGCGGCACCGAGGACGCCTCCATGTTTGCGCCGCCGCCGCCACCGCCCCGTCGAGCCGATGGT
CGAGGTGGTGCTCACGCCTACGGTCCAACGGTCTCCCCTCCCTTTCTTCCTTCCGCCACTGCTGATGCGCCGGCCGGCTA
CCTGCCCTATCACTGGCTCGAACTCGCCGAGATCCTCCTCGCTCACGCCCCCGACGACCTTCCCGCACCCCCCGGTGATG
TTCGTGGCCTTCTCCGCGACCTCGCTGAAGCTCGTGCCGCCAAGGTCCGCCAGCTCGCCGTCGCTGCCGCTGTCGCCAGC
ACCGGCACCTCCGCCCATCTCGCCAGCTCGAGCCAACTCGACAGCCCACCGCTCGTCAACCTGCGTGGCATCGGCGCCAT
GGAACTCGCCGAGTCGCGCGGCCTCGTCACCGCCGTCCACAACGGCGTCCGCCGGCTTGGCGCCGCTGCCGAGGCCAGTC
GCCGTGACGACGACGAGGCTCAGCTTGGCGACGGATCACACCGTCCAGGCGGCCAAGACTACGACGACGACGACGAAGAC
GAAGACATGGGCATATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62