GenePrediction:GLEAN_7907 Details

Name: GLEAN_7907
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2302798..2300952 (- strand)
Length: 1847
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2302798..2302540 (- strand)
Length: 259
Type: CDS
Source: GLEAN
Position: GCSC_113:2302455..2301485 (- strand)
Length: 971
Type: CDS
Source: GLEAN
Position: GCSC_113:2301425..2300952 (- strand)
Length: 474
>GLEAN_7907 class=GenePrediction position=GCSC_113:2302798..2300952 (- strand)
ATGCCCTCCTATGGCAGCACGCGGAGAAATGGCGTCGATGCAGCCAAGGGCCCTCCCACGAGTACTTCCGTGTTTGCAGT
CCCCAACAGCAGCAGTAGCAGCGCCTCGACACCACTGCTGCAGTCAATTGACGACGCAGACGGCAGCAGCCCACACGATG
ATCACCACGAGACCGTCCCTGACGAGCATTCGCCAGAGCGGCGGCTGGGCATCGCCGGAACTGTCTTTCTCATTCTCAAC
AAGATGATCGGTACCGGTAGTGAGTCACCTCCGTCCTGACTGCTCGATTAGCCATCCCGTCGTGTCTACGTGGCTGACAC
ATCCCTCTTCCTCTTGCTTCCAGTCTTCTCCACTCCTGCCAGCGTCTTTGCAGCGACCGGTTCGGTCGGCCTGTCAATCC
TCCTCTGGATCGCTGGAGGCGTCATCATCATGGCCGGACTCAGCACGTACCTCGAGTTCGGCCTGGCCATCCCGCGGTCC
GGTGGCGAGAAGAACTATCTCGAGCGTGTCTACCGCCGCCCGCCGCTGCTGGCCACCTGCATGCTGGCGTCGCAGATGGT
TCTGCTGGGCTTCTCGGCCGGAAACGCTCTCGCTTTTGGCCGATACGTTCTCTATGCCGTCAGTGATGGCGGCTCCATGG
GCGCGACCGACGGCTGGCTTGCCCGCGTCATCGGCGTCGTGCTAGTCATCGTCGTCATCGGCCTGCACTCGGTGGCACCG
CGCTGGGGCATTCGACTGTTCAACACCCTCGGCGTCTTCAAGGTCGGCGTGCTAGCCTTCATCGTCGTCACCGGCTTCGC
TGCTCTGGCCGGCTATCGCCGAGTGCCCGACCCGCACAACTTTGACCGGCCCTTTGACATGAGCGATCTCGGCCGCTACG
GAGGCGGTGGCGCCTATGCCTACGCATCCGCGCTGCTCAGCATCATCTACAGCTTCAAGGGCTGGGAAAACGCTAACTAC
GTACTGTCCGAAGTTCGCAACCCGCGCCGGACTCTCATGGTGGCTGGCCCGCTGGCTGTTGGCCTCTGTACTGTGCTCTA
CGTCCTCGCCACCGTCGCCTACTTTGCCGCCATCCCAGCCGACGACCTTGCCGCTTCCGACGTTATCGTGGCCGGCCTCT
TCTTCCGCAACGTCTTTGGCGACGGCGCCGCCGCTCGTGTGCTGCCCATCTTTGTCGCTGTCAGCAACCTCGGCAACGTC
CTGGCCGTCAGCTTCGCCCATGCCCGCTTCAATCAGGAACTGGCCCGCGAAGGCATCTTGCCCTTTAGCCGTCTTCTGGC
ATCCAGTCGACCATTCAACTCGCCGGCTGCATCCGTACGTCTTTCTTATCTCATTACCGCTTGGCGAACACCCAACTGAC
ACTCAAATCACAGCTTATTCTGCACGGGATCATCACTATCATCATTCTGGTGGCTCCGCCCCCTGGTCCTGCCTACAACT
TCATCATCAATCTCTACGTGTATCCCGGCACGGTGGTCAACATATTTGTCACCGGTGGCCTGTTGTATCTGCACTACAAC
CGCAAAAAGGAGGGTTGGTTGTCGCCCTGGCACACACCATGGCCCGTTGCCATACTGTTCCTCTTAAGCAACGTCTTCTT
GATGATGGTGCCCTTCTGGCCGCCGGCACCAGGGTGGGACCCGGAAGGCTACCCATACTACATATTCCCTGTCGTTGGGG
TCGGTGTCCTGGTGCTTGGCGCTGTATACTGGCTGGTGTGGACCCAGATCGGTCCGTGGCTGGGCAGCTACCGACTGGAA
CCAGAGCATGTGCGGGGCGATGATGGTATCACCGTCGTGCGGTATAAGCGGGTGAAGAAGGATGATGCTGAGGAAGTGGA
ACAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62