GenePrediction:GLEAN_7909 Details

Name: GLEAN_7909
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2287477..2285466 (- strand)
Length: 2012
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2287477..2287175 (- strand)
Length: 303
Type: CDS
Source: GLEAN
Position: GCSC_113:2287063..2286317 (- strand)
Length: 747
Type: CDS
Source: GLEAN
Position: GCSC_113:2286262..2286237 (- strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_113:2286179..2286091 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_113:2286022..2285466 (- strand)
Length: 557
>GLEAN_7909 class=GenePrediction position=GCSC_113:2287477..2285466 (- strand)
ATGGCTCTCTCCATTTCCACCCTCGTTCGAGGTGCAGTGGTCTTTGCTCTGCTCCCTTTTCTATGTGGTGTCATTGGCAC
CTCAGTTGCCGACGCGGGTCTTCCTGCCCAGATGGACTCTGAAGCCATGGAGAACATGAAGGCCTATGTCAGCTCACAGC
CACAATTCTCCGAGTATTCTCCTGCTGAAGACTTCACATTTGTCTCCGACTTTACAGCTCCCCAAGCCGACTCAATTGCA
GAGCTAATGCCCACGGCTGATATTGGGTTTACACCTGTTGTTGAGGATTCGCTCGAACCGGAGGTATGTGCTGACAACGC
ATATTTCCTCCAGTCCTTACAACGGACGCCAAATACTTGCCCCGTTCCACTGAGTCGTGATGGTCACCGCCGTCACCGCC
GATTTCCCCGCAAGAATCAGACGGCTGTAGACATCCTCGACAGTTCGCATAGCAACCCGGCGGACCCCAAATCCTGGAAA
CCATGGACGCACCCCCCTGAATGTGGTGTTGCCAGCAGCTATTGCGTATTCACTCAGACGACACTTCCGGCGTCTGGCAG
AGGCATCCTGGACAGCAACAATATGGCTAGCAATGATACCTCGCCCCAGGGCATCAGCATTATTACCACTCCCGAGCAGG
CTGCCTACAGCCTCAACCCGCTCGAGCTCTCGTTCGCCCCGGAGTTTCTCGAGATCTACAAAAAGTTCGCAGACCTCCCA
CCGGCCTTTGCCGTCCATCAGCATCCTACCTCGCCCCTGAAGGGTGATGGTTTGTTCGCTACCAGGTCCATCCGCGCAGG
CGAGCCGGTCATCGTGGACAGGCCAGCCCTGCTGGCCCACTTCAAGGTCATGACGGACGAGATGACCAGGGCCCTTGGCT
CAGACGAGGACGACCACGGTCTGGGCCCCGAGACAGACAGTGATCGGACACGCATGTGGAATGCCGCAGCCGAGCGGCTG
CCCCCACATATAATTGACCGTATCTACAACATGACCGTGCTTCCACGCTACAACAAGCTATTCCAGATGTTGCCCGCTGA
AGATTTCTCACCGGAGAATGCGCCGCCGGTATTCTCGCACATTGAGAAGGTGTTTGCTAGCAACTCTTTCGCCATGACCG
TCAAAGGCTACGCGTACAAGGCTCTCTTTCCCAATGTTGCTGTAAGAACACCTGATTCCCTTCACGCTGTGCAATCAATG
CTAATTGCACATTAGAAAATCAACCATGATTGCCGGCCAAAGTGAGTTTTTTTACTTCATTTGAATCCTTTGTCGTGCAT
CCATTAACTTTGCAATAGTCTATCTGCCGACATTTTTGGCGAAACAATGACCATGGTCGTTTGGGCCAATCGAGACATTG
AAGAGGGCGAGGAGCTGACTATCAGCTGTAAGTGAACCACAGAATACAACTGCCCACCTTTCTTCCAATATGCTCATTCT
GACCATCGACGACAGATCTCAACGACCTTCTGCCATCCGACAGGCGCAGTAAGGTCATCAAGCGCCGTTGGGATTTCCAG
TGCCAGTGCGACCTCTGCACCGGTAAGGCAGATGGCGCGCTTGAAGCCTCGGATAAGCGTCTGCAACACATACCTTCCCT
GATCGGTCAGATTGCCAGGGACATGGCTGACAGCCATGCTGATAAGGCACTAGAGGCGGCGCTGGATCTGCGTGCCATCT
ACATTGGTGAGGGCTTGATGCGGGAGACGACCACAACCGAAAAAATGCTGCTTCTGCCAGAAATGTCCGAAGAGGAAAGA
GATCGGGTCAAAGACGATCTGATGGCGGACCCGTTCGGCCCAGCTGGTCTTGCCAAGCTGCTTGGCCGGTTGTACTTAGC
CAACGGCAAAGAAGCGGAGGCTCTGCCCTATCTGCGTGCAGCCGTGACCGAGATTGGACGGCAGACCTTTGCGTGGCCAA
ACCCGGAGAAGATGGCAGAAATGTGGCATCTTGTGCAGCTGGTGGAGGCAGCCGAACGAAAAGTCGACAAGAAAAGAAAA
TGGTTTCTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62