GenePrediction:GLEAN_7910 Details

Name: GLEAN_7910
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2281672..2279586 (- strand)
Length: 2087
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2281672..2280504 (- strand)
Length: 1169
Type: CDS
Source: GLEAN
Position: GCSC_113:2280336..2279586 (- strand)
Length: 751
>GLEAN_7910 class=GenePrediction position=GCSC_113:2281672..2279586 (- strand)
ATGCCGCCCAAGCAGAACCCATCCGCTCCTCTACCCAACCGCCCCAAGCGTAATCGAAAGCCAAGCCTCCAGGCCATCGA
GGCGGCTGAGAACAAGGCCGCAGAAGAGAAATGGCTAGCCAAGAGAAGGAAGGGAAAAGCAAAGAGGCAGGCTCAACAAG
CGCAGACAAATCCCTTCAACGTCTCAGCGCCGGCTCTAGCATCAGTACCACAGCAGCCTCTTCCACCACCTCCAGCAGCT
TTGCCAGCACTTCCGGTGCCGGTCTTACCGGCAGGCCCGCAGCCTCCAGTGCTACCACATCCTCAGCAAACTCAAACGAT
AAATCAAGGAATGGCTCAGTTGGTGCTACAAACACCAATAACTATACCACGACCTCTAGCACCGTTGGCACCACCTCCTC
CACCGGCTCTGCCATCCGGGCCACCGCCGCCTGTTCCGCAGCCACTGCAGCAGCCACCTTCTGTTTCTGTTTCGGCTCGA
ATAGTGCCACAACCACAGCCACATCCAGCTTTGGCACCACATCCAGCATTGGTTCTACCATTGACGCAATCGTCGGTGCC
CCCGGCAGCTCTAGCACAAACTCGAGGACAGGATGTGCACAGATCATACGTGGACGCCCTGCAGTACGAACGTGACAGTT
ACAATAATCTGCACGACTATTTTCTGGTGGAACAGACTATGAAGGTGAGGACGCCCGTGATCAGATGGGACGATATGAAA
CCGCCCACGAATGAACCAATAGTGCCACTGAGCCACGAACACGAGCCTCCCACGCCTCAGTTTCCCCATCCAGATGACAT
CGAGCCTAGCAAACGTTCCAATCACGTCTTTGTCAGTGGTGCCAGTGGTGCCAATGGTGCCTTCGGTTTACAAGGAGGCG
GCTTATGTGGTGGTGACCATGCTGGTGCTGCTGCCTCTGGCGATGATGATCTTCCACCTCCACCAGCTGCAAAGCGGCGC
CGCAATCGGAAGCGGCCAGTATCGGCGTTCTCGAAGCCGCCGGTGGCGACAAAAAGACCACCATCGCAGCCAAAGAAGGC
TCCCACTTCTGTAGCAGCCCCTGTGCAGCTGCCTTCGACTTCAGTCATCGCGCCTTTGTTGAGAGAACACACCCTCTACA
TGGCCCGGAAATTTGGACGAATCTGGAAGCAGGAGCACGCTCAAAAATGGTATGCGTACATTTGGTGGCGGCATCGAAAG
CAACGGCACGTTCAACCCTCATTGGCGAGCTCTTCCCTGGCCAACAAAGAAATTACATGTCAGGCCTGCATAGATGTGTA
TGTTCGCAGCAACAGATTTGTACCTTCCGACGAAGAGCGCTGACATGTTGCGATAGTGCAATGCTGGCAATGCACGCAGA
CGTTCCGTCATTTGTGTCACCATACGCTTTGAAGTCGCCGTCTATCCCATCATGGAACTCGTTCAAAGCAGATGAGCCAC
GCAACCGCGGCTCACAGCATGACTCGCTCAAAAGCTTCCTCGAGCACCTGCTGTCGCTAAATGTGTCCCATTTACCCATC
AGCTCCTCAGACTCGGCCTTGGTTGCAGAAGGCCCAACCTGTGGCAGCAGCGATCTCTACTTGCCGGAATTGCAATTGTC
TTCGCAAATGCCGATAGTGATGCCCCCACCTCCGACCCCCCAGCTGGTATCAGAACATTATTTCGAAAGGGACTCCCCTG
TAGACGATAACACGAGCAACAGCATATCTCCAGGGTCCAGTTCATGGTGGCACCCACTGGAAGCGGCTGCTCCCTGTGGC
CGGGAAACGTCCTGCGCAAACGTGGGCTGTCCGCGTTGCTACTACATGGCTTGTCCATGCGTATGCCACAAGGACGCGTC
CAACTCGTTTGTTTCAGCTGGCCGTGACGAACCAGAGGACTGGGTCGACTTTGACACGGCACTGACCGATGTGGCCACAG
GAACAGAAGAGCTTCCTACGAACGGGAACTCAGAGCGACGTGCAGCGGCCGCGGCAGGAATGGTGCCGGCTATAATACCT
ATGTTTCCTGCTGAACTTTTCGGCCGCAACGAAGGTGGCAAGTTAAGCCCGAGGAGCTTTGATATGGATTTGGCGCCATA
CGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62