GenePrediction:GLEAN_7911 Details

Name: GLEAN_7911
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2278686..2274608 (- strand)
Length: 4079
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2278686..2277660 (- strand)
Length: 1027
Type: CDS
Source: GLEAN
Position: GCSC_113:2277053..2276363 (- strand)
Length: 691
Type: CDS
Source: GLEAN
Position: GCSC_113:2276075..2274608 (- strand)
Length: 1468
>GLEAN_7911 class=GenePrediction position=GCSC_113:2278686..2274608 (- strand)
ATGGCCAAGAGATCTACCAAAAACGCCATCGCCAGTCGCGCCGGTCGCGGGAAGTTTCAGGGCGGCAACCGGATTGCAGC
CCGGCCCATTCGGGAGCAGGCCGGTGTTTTGCTCAAACGACGCCTAACGTCTGCCTCGCGTCAGAAGACTGTGCAGGAAA
CGCGGGCGGTAGAGTGGCAGAGGATGGCGGTCCCTGCTGCCGTCACCATGGGGGCCATGGCCAGCACATCAAACGAGCTG
GTCCCCATTGCCGGGCTCCCGTCCATCGACGACGTCTTTCCAGAGTTCGGCCAGGGCGAGATCCCGACCATGGGGGCCAT
GACGGCCAGCACTTCTTACATGCTGGCCCCCATCTCTGGGCTTCCATCCATCTACGACGTCTTTCCAGGGCTCTGTCCGG
GCTCGGAGCCTCTGCCCCTGCCGGACACCAATCGCCGGGCGGTGCCAAAGTTCGAGATCTGCGGGCAGCAGAACTGCGGC
AAGCATCCTGAGTTGCATCCGTGGTGGCAGTGGCCGTATCCGGCGACGACGTGCTACAAGTGTTTACGTCAGAGCACACC
GAATGAGCTGCACGCGCTTCCTTGTGGCCATGCTCTCTGCCATGGCTGTCTGGAGCAGACCGTGGCCGAGATCAATGCGA
ACGTGCAACACGAGAGCTCCTGGGCCGAGATATCGACGCATCTGGAGGAGCACTGGGCAGCATCCAGTCCCAACGGCGGC
TCCGGACAGCTCGACAGCAGACAGCCAATCCTGAATAGCTCCCCACTCGACCGCGCCATGGCCGCCGCCGGCTTCCACTG
CTGCGGCAAGAACATGCACCTGGAGCGCTATGCGATGTGCATGACACCGCACACGGTGCGCACCTTCTGGCTGGCCTGTG
AGGCCATCCGCTGGCCGCTCGATATGGCGCGAAACCGGTGCGGATGGCCTGACTGCGGGCGCCTGGTCAGTCCCACTTGT
TCCTACGTGCGCAACCACGGTACTGTGTACCATTGCCTGTACTGCCAGGGCAACTCGTACTACATCTGTAAGGGAAATCT
CGTCCCGGCACGGTAGATAGTTTAGACTTTATGAATGATGACTAAGCAGTTATGATACAAACCGGTGGCCGATGATCTCG
TAGCCTATAGCCAATCATGCTGGCGGATAATTTTTCTAGCCAGGAAGTGCGCTGTGCCTAAACCGGACATCTCCTATCGA
ATCCACTGGGGGTCTGGTACGGAGTGCACACTGCCGGTGCCGCCTACTGCCGAAATTGGCGCCATAAGTGGTACTTGATT
TAAAATACGAAGCAGAACAATTACAGTTTGATCCTGATATTTCTGCCATTTTGTCCTTGTTTCTGCTCTGGCCTTGGGGT
TAAAGAGGGAGATGGTTATGGCAGCGCGACTTCTGGTTGCTGAATATCCTTTTTCTTGCATATATTGTATATTCGAATAA
GCGAGCATCATGACCACGGCGGGGTTTCTATCCCGAGGTTTCGCGCGGCCAAACAGCGACAGTTTAGGCCGTCACGGCCG
CCGAACACATCACAGCCAGCCACATTTTCGCCCTCAGTCGTTGCTGCAGCTACGTGGTGGACGCGGCCGTCCCCAGTCGA
CAGCCACTGGACCTAGATCTGGATCTACGACAGGCAAGACTCTGCCGCTTCCAAAGTCGAAACCGCAACGCAAGAGCCTT
CCGGCACCCGGCCCTCCCAAGGAAGACCCGATCCCGATCGCTAACAATGTGTCACCGCTGCCGTTGTGGCAGCGCTTGGG
GCCATTGACACGCGCTGCTGAGGGTTACGCGCGAGCACAACGCAACCGACCCTATGTGACACAAGTATGCAGCTCCCTGG
TCATCGCGCTGTGCGCTGATCTGTCGGTGCAGCGAATGAGCGCCTGGGTGGCGGAGAAGGAGGTCGTCCCGACAGATTCA
ATCACCCCGACCTCTTCTTCCCCCCTGTCCACATACTCTTACGATCCCGTGCGCACTGCTCGCTCCCTTGTCATCGGCGC
CATCTTTGCCATTCCCACTTACCGCTGGTTCATCTTCTTGTCGCGCAACTTCAACTACTCCTCCCACATCTTCTCCCTCA
CCGTCAAGATCGTCGTCAACCAGCTCTGCTATACGCCTGTCTTCAATTCCTATTTCTTCGGCATGCAGGCGTTGCTGGCC
GGCGACACGCCTCAAGAGGCCTTCGATCGCGTGCGCCGCACTGTGCCCATCAGCTTTGTGAACGCTCTCAAGCTGTGGCC
CGCAGTGACCGCCTTCAGCTTCACATTTGTGCCGATGGAGTATCGGAGTGTTTTTTCGGGCGTCATCGCTGTAGGCTGGC
AGACGTATCTGATGTACCTAAACCGGACGGCGGAAATGGAGGAGGGAGAAAGGCTGAGACATTGCGCGGAATCCGCTTTA
TTACGATGATCAGAGTATCCACAAATAAATTAGTAAGGCGTAGAATTTTACAAGAATCAACACCACCGTATATGATACGA
CTTCACTCTAGTTATGCAAGCTCTTCTTTTCTTTCTTTTCTAGAAAAGATGGCGCTCCCGCGTCTCCGCCCACGGGCGTT
ATTGGCAATACTCCGGCCGCAGCCTCGACTGACCTCGGTCACCCGACTCAGTATAAATACAAACCGATCTGTCTCAACCT
CTCCCCACTCAGAAGCTGGTGTTTCAGCCCCCTCAACTCAAACTCCAGGCTCGGAGCAGTCCCAACCTGTCTCGAGATTG
CGATCGGCCTTCTGGATAACGTCCATCAGCCTGTCCGTATTCGCTACATACCTCTATGCCACAGACACAAGAGCATCGGT
CCACCGTTGGTTGGTGCCGCGCCTCCTGCGCCTAATCTACACGGATGCCGAAGAGGCCCACCACATCGGCACGCAGTCTA
TGAAGATCCTGTACCAGTTGGGGCTCCACCCACGCGACCGCACAGACGACGAGGACTCACAGAAGAGCACGCTGGCTACG
ACCGTGTTCGAGGAGCCCGACAGTTTAGCGCTCAACAACCCCATTGGCATATCTGCCGGTCTCGACAAGAATGCAGACAT
TCCAGACGCGCTCTTTGCTCTGGGTGCTGCCGTCGTTGAGGTTGGCGGCTGCACGCCGCGTCCACAGGCTGGCAACTCGC
GGCCGCGCGCATTTCGCGTCCCCGCCATCGAAGGCTTTGTCAACCGCTACGGACTGAACTCCATTGGGGCTGACGCCTTG
GCCTCGCGTCTGCGCGCCCGTGTCCGCCAGTTCTGCCGCGACCACGCCGAAAAACACCTCACCGAGGCGGACGTCCTGTC
AGGCGCTGCTGGCGTCCCCCCGGGCAGCCTCTCACCCGGCCGTCTGCTGCTCGTGCAGATCGCAAAGAACAAAGACACAG
ATGAACGCGATGTCCGGGCTGTCGCTGAAGACTACACCTACTGTGTTCGCCGTCTTGCCCCCTATGCAGACGTCATCGTC
GTCAACGTCAGCAGCCCTAACACGCCTGGCCTGCGCGACCTGCAGGCTGTCGAACCTTTGACGCGCATCCTGGGCGCGGT
TGTCGATGAGACTCGAAAGTCGGCCAACAAACTCACTGCTATGCGGACCATTCCAACTCGAGTTATGGTCAAAGTCTCAC
CTGACGAAGACAGCGACAGCCAGATCGACGGCATTTGCGAGGCTGTTTGGGCCAGTGGCGTCGACGGCATCATTGTAGGC
AATACGACCAAACGCCGAACAGGCCTCATTCCGGAGAAATTGCGCATTCCCGTAGATCAGCAGCGGGCCCTTGCTGAAAC
CGGTGGATTCTCTGGTCCAGCCATGTACGGCCGTACTCTGGCGCTCGTGAAGCGTTACCGTCAGCGGCTTGACGAACAGG
CACTGCATCTCACGGCGCCGATGAACAAAGACAACGTTAAACCTGTGGCACGTAAAGCACTGTTCGCATCTGGTGGCGTC
ACAACGGGAAATGACGCTCTGAACTTGCTCAACGCAGGAGCTAGCGTAGCGATGGTGTACACGGGCTTGGTGTATGGTGG
TGCCGGGACTATCACAAGGGTGAAGCAGGAACTCAGAGACGAGATTGCTTGTTTTGATGTAAAAGAAAAGGGTATATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62