GenePrediction:GLEAN_7912 Details

Name: GLEAN_7912
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2261501..2259321 (- strand)
Length: 2181
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2261501..2261477 (- strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_113:2261372..2261244 (- strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_113:2261155..2259588 (- strand)
Length: 1568
Type: CDS
Source: GLEAN
Position: GCSC_113:2259527..2259321 (- strand)
Length: 207
>GLEAN_7912 class=GenePrediction position=GCSC_113:2261501..2259321 (- strand)
ATGTCGACGTGGAAATTGACAAAGAGTGAGTGCTGAGAGAGAGACCGGAAGAATGCACGCAAGCATGCAAGCGTGGCGGT
TTTGAAAGCAGCAACAGCTGACCGCTTTATTTTATTTTTCGTCCTGCAGAGCTGAAGGAGACCCATCTGGGTCCTCTGGC
AAACTTTTCCCGATCAACGTCCACGTCCACAATCACGGCCGAGAAGGATGCGCTGACGGCCACCACCCCCGTTGCCGGGG
CACCTTCGAGCAATATTGGTACGCTTAAGATGCATGGGATGTATGGGGTGGCTGGGAAGTCCATGGGGGAGCCTCCTCTG
GCTTCAGCTGCTGACTTCTGCACTAGCGGCATCCGAAGCATTAAGCCAAGCACCCGTCATCAAGCCGCCAAAGCCCGGTA
TCCTTGTTGTCACCCTCCACGAAGGTCAGGGTTTTGCCCTTCCCGAACAGCACCGCAATGTGTTCAGCCCACAGCACCAG
TCGTCCATGTCCACGGGCAACGCCCTGGCCGGCAGTAATGCCAGCTCGGCCCGGCCAAACTCGTCGCAGCGTCAGGGTGC
AGCCTTTGCAAACGGCAGCCGGCCACAGACGGCTGGTGGTAACGGGTTCAACGGCGTGCCCACCAACCACGGCCGCATTT
CGGGCAAGTACATGCCGTATGCGCTGCTGGATTTTGACCGCATGCAAGTCTTTGTCAACTCGGTTGAGGGCACGCCCGAG
AACCCGCTCTGGGCTGGCGACAATACGCAGTACAAGTTTGATGTGTCCCGTGTCACCGAGCTCGCCGTGCATCTGTACCT
ACGCAATCCGAGCGCACCGCCAGGCTCCGGCCGCAGCCAGGACATCTTCCTCGGCGTGGTGCGCATCAACCCGCGCTTCG
AGGTGCAGCAGCCGTACGTCGAGGACCCGAAGCTGAGCAAGAAGGACCGCGAAAAGGCGGCGGCCGAGCACGCAAGCCGT
GAGCGGGCGCTCGGCTTCGGCGGCTGCGAATGGGCCGAGGTGCAGTACGGCCAGGGCAAGCTCAAGATCGGCGTCACATA
CGTGGAGAACCGCGCTGGCAAGGTGACGATTGACGACTTTGAGCTACTCAAGGTCGTGGGCAAGGGCAGCTTCGGCAAGG
TGATGATGGTGCGCAAGAAGGACACGCGCCGTATCTACGCGCTCAAGACGATCCGCAAGGCGCACATCATCTCGCGGTCC
GAGGTGGCACACACGCTGGCCGAGCGGTCGGTGCTGGCGCAGATAAACAACCCGTTCATTGTACCGCTCAAGTTCTCCTT
CCAGTCGCCTGAGAAGCTGTACTTTGTGCTGGCCTTTGTCAACGGCGGCGAGCTGTTCCACCACCTGCAGAAGGAGCAGC
GCTTCGACATCAACCGGGCACGCTTCTACACGGCCGAGTTGCTGTGCGCGCTCGAGTGTCTGCACGGCTTTAACGTCATC
TACCGCGACCTGAAGCCGGAGAACATCCTGCTAGACTACCAGGGCCACATTGCACTGTGCGATTTCGGTCTCTGCAAGCT
GGACATGAAGGACGAAGACCGCACGAACACGTTCTGTGGAACGCCCGAGTACCTGGCGCCCGAGTTGCTGATGGGACAAG
GCTACAACAAGACGGTCGACTGGTGGACGCTGGGCGTGCTCCTGTACGAGATGCTGACGGGCCTGCCGCCCTTCTACCAC
GAGAACACCAACGAGATGTACCGCAAAATCTTGTCGGAGCCGCTGTACTTCCCCGGGTCCGACATTGTGCCGCCGGCGGC
CAAGGACTTGTTGACGAAGCTGCTGAACCGCAACCCGGCCGAGCGTCTGGGTGCCAACGGGTCGGCAGAGATCAAGGCGC
ACCGCTTCTTTGATGCCATTGACTGGAGAAAGCTGCTGCAGCGCAAGTACGAGCCGGCATTCAAGCCGAGTGTGGTATGT
TCTGATTTTTGTTCCACTATTGTCTCTCTGCATACCCCTTTTCTAACAGACCAGACCGACGCGCTTGATACGGCCAACTT
TGATCCCGTATTCACGACCGAGGCGCCCCAAGACTCGTTCGTCGAGGGTCCTGTGCTGTCCCAGACACTTCAAAACCAGT
TCCAGGGCTTCAGCTACAACCGGCCGATTGCCGGGCTAGGCGATGCGGGCGGTAGTGTCAAGGACCCGTCATTTGTGGAC
AGCATTCAGGACAGCAGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62