GenePrediction:GLEAN_7913 Details

Name: GLEAN_7913
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2257652..2255777 (- strand)
Length: 1876
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2257652..2257129 (- strand)
Length: 524
Type: CDS
Source: GLEAN
Position: GCSC_113:2257061..2256528 (- strand)
Length: 534
Type: CDS
Source: GLEAN
Position: GCSC_113:2256475..2255933 (- strand)
Length: 543
Type: CDS
Source: GLEAN
Position: GCSC_113:2255864..2255777 (- strand)
Length: 88
>GLEAN_7913 class=GenePrediction position=GCSC_113:2257652..2255777 (- strand)
ATGCCGCAGGCCAGCGCACTGCCCGTATGGGCTGAGCTTCAGAAGCACCGCGACACCGTCGGCAAGGCGTTTGTCCTCAA
GGAGGCGTTTGCCGAAGACCCGAAGCGTTTTGACAAGTTCACACGGGTGCTCAAGCTTCCCGCCAGCATCTCGAGCAACG
ATGGCGAGACTGAGATCCTGTTCGACTTCAGCAAGAACTTTCTGACGGGGGAGACCCTGGCTCTGCTGCTGAAGCTGGCC
ACCGAGGCCAAAGTCGAGGAGAAGCGCGAGAGCATGTTCAAGGGCGAGAAGATCAACTTCACCGAGGACCGTGCCGTCTA
CCACACTGCTCTGCGCAACGTCGGCTCGGAGCCCTGGACCATGACCGTCGATGGCGTCGACGTAGTCAAGACCCCTGGTG
GCGTTGCTGACGTACTCGACCACATGAAGGAGTTCAGCGAGGAGGTCCGCAGTGGCTCCTGGAAGGGCTATACCGGCAAG
AAGTTGACCAACATCGTCAACGTCGGCATTGGTGGTTCTGACCTGTACGACAGCTTCCTTTTCTTTCCTCCCCCACCGAT
TACTCCAACTTGGCGCTGACCGAACAAACAGGGGCCCTGTGATGGTGACCGAAGCCCTGAAGCACTACGGTGCGCCTGGC
ATGACACTGCACTTTGTGTCCAACATTGACGGCACCCACATGGCCGAGGCGCTGGCGGCATCTGACCCAGAGACGACGCT
CTTCCTCATCGCTTCCAAGACGTTCACAACGGCGGAGACGACCCGGAACGCCAACACGGCCAAGGACTGGTTCCTCGAGA
AGACCGGCGGCAAGGGCGAAATTGCCAAGCACTTTGTGGCTCTGTCCACCAACGAGAAGGAGGTGACCAAGTTCGGCATT
GACAAGAAGAACATGTTCGGGTTTGAATCGTGGGTTGGCGGCCGCTACTCTGTGTGGAGTGCTATTGGCCTGTCCGTCAG
CCTGTACGTCGGCTTCGACAATTTCCACAAGTTCCTGGCCGGCGCCCACGAGGTTGACAAGCACTTCCGCACCACACCGC
TCGAGGACAACATTCCTGCCATTGCCGGTCTTCTGAGCGTCTGGTACTCTGACTTTTTCAACGCCCAGACGCACCTCGTT
GCTCCGTAAGTATACCTCGGACCTGGAAAGACGCTGTTTCGATCTAACACCTCACAGGTTTGACCAGTACCTCCACCGCT
TCCCAGCCTATCTCCAGCAGCTGTCTATGGAGTCCAACGGCAAGACGGTGACGTCTGACGGCAGCGCGGCCAGCTACACC
ACGGGTGCCATCCTTTTCGGCGAGCCCTGCACCAATGCGCAGCACTCGTTCTTCCAGCTGGTGCACCAGGGCACTAAGCT
GATCCCCACCGACTTCATCCTTGCTGCCAAGTCGCACAATCCGATCTCAGACAACATCCACCAGAAGATGCTGGCTTCCA
ACTACCTGGCGCAGGCTGAGGCCCTGATGGTCGGAAAGACGGCTGACCAGGTACGCGCCGAGGGCGGCGTGTCGGAGGCG
CTGGTGCCGCACAAGGTATTTATGGGCAACCGGCCGACGACGAGCATTCTTGTCAGCGGCGTGATCGGCCCGGCCGAGCT
GGGCGCTTTGATCGCGTACTACGAGCATGTCACCTTCACCGAGGGTGCTGTCTGGGACATCAACTCGTTTGACCAGTGGG
GTGTCGAGCTGGGCAAGGTGCTTGCGAAGAAGATTCTTCAGTACGTCACACAGTGCAGAGTGATGGCCTACTGCTTTTGG
TGTTTCAGATAACTGACCGTTCGATTAGGGAGATTGACGAGCCGGGCAACGGCACGGGCCACGATACGTCAACCGGCGGC
TTGCTGTCTGCGTTCAAGAAGTATGCTACGATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62