GenePrediction:GLEAN_7915 Details

Name: GLEAN_7915
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2245463..2243570 (- strand)
Length: 1894
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2245463..2245135 (- strand)
Length: 329
Type: CDS
Source: GLEAN
Position: GCSC_113:2245075..2244926 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_113:2244317..2243570 (- strand)
Length: 748
>GLEAN_7915 class=GenePrediction position=GCSC_113:2245463..2243570 (- strand)
ATGGTTAGCAAGATCCCGGACGGGCTCGCAGATGCCCACGCTATGCAGGATCAACCCCACAAGAACACCTCTCCTGAGAG
CACGCATGCCAACAGGCTGACCATCATGAATCTTCCGCCCGAGATCCACATACAGATCACACGGCAACTCATCTATCCCG
ACGCTCTGTCCCTCAAGCACACCTGCCGCTACTTTTACACCTTTGTCGACACCGGGATCAAGCTCAAGGTCGACTGGTTT
CTGTCCCGTCGGCGTCTCCATCTTGACTGCCCCAACGAGACCCGCTGCGACCTCGGCAGTGATCTTCGTTTCTGCCGTGG
AAGCGTTCCGTAAGTCTGCCCTTCATGTCCCATGCCGGTGCCGGATGACCACTTACAGTCTTCGCCAGCCTTCTTATGAA
ACGTCGCCGCGAGCATATCGAATGCGAGAGCCGTCCTGGCTTGGGTTGCCTTATCTATGGCACCGCAACTTGCACACACC
GGCGTCGTCCTGGATTCTTCCAGCGCTGGTTCCGGAAGCGCCTGACCGTGGAGATGTGGTGGGTACTGTTGGCACTCGTA
CCACTGCTGTTGTCGTCGCTGTGGTTTGTTGAACTCCTCAAGTCCATCTTCTCCTGAGGTTCATGGACCTCGTCTTGGGA
CGATGGGGTGACTGTTGCGCGTATATCACGATTCCAAAACGTAATCAGCTGTGCCGAATAGTGTAGGGTACGATCACCAA
TTAGTTGTATGATATAGAACAAAAAGTGTAAGTCGCTCGCATGTAGAAAGTGCAAAAATGCAAAACGTACAGCAGCGGGT
ATTCGCTGGTCGTCACCGACCCAACTACTAATCCGCCGATTACTGGTTTAACTAGGGGAGAGCGGACGGGATCCCGTGCT
TTCCAGTATCTATGGCCGTACGTGCTAGATTTAGGTACAGCAATGTCTTGTATAAACTGGTGTGGATCACTTTCACGTGA
CCGTGCGGCCCTGAGAATGACGGCATTTCTGCGTTTGTCCACCTTTCAGCCCCTCTCTGCAGCTCTCGTTAACCAGCTCT
AGACTGCAAGCGTGTCGTCTGTTCTTGTGCAAATGCTACTCGGAACACGCTTGCTTGGCTCAATTCGAAGATACCGACAG
AAGACACCATCTCGGCTCTCTCTCAGCACATCTGCGCCGTCCCTCTCGGTCTTCTCGGCCTTCTCGGTCTTCTCGATCTT
TCCAGTGTCTTCTGAGCCCAGCAGCAGCCGCCGCACCTTTTCGGCCACCATGTCGTCGTTTGCGCCCAGCCCGAAGACAC
AGGAGCCGGTGATCACGCGGGTGACGGACCTGAGCACGGCCGACGCCCGCTGGATCGCGCTGAAGCGCATCGAGTACGTC
GACCAGGTCGGCAAGGCGCGCACGTGGGAGGTGGCGACGCGCAAGACGCGCGGCAGCGCCGGTGTTGATGCGGTGGCCAT
GGGCAACGTGCTGCGCCACCCATCGCGGCCGCCGGCGACGCTAGTCGTGATCCAGTACCGGCCGCCGCTGGACGCCTACA
CGGTCGAATGGCCGGCCGGACTCGTGGACGCGACCGAGACGGCCGAGCAGGCGGCCGTCCGCGAATTCAAGGAGGAGACC
GGCTACGACTGCCGCGTCGTCAGCGTCAGCCCGCCACAGGCTGCCGACCCTGGCATGACCAACGCCAACATGCAGCTAGT
CATGGTCGACGTCGACCTGCCGGCCGACCACGACGGCCGCGCCCCCGACCAGCGGCTCGAGGACGGCGAGCACATTGAGC
GCGTCACCATCCCGCTGGCCGACTTCTACGATCGATTGGTCGAGTATGCCGCCCGCGACCGCTTCGTCGTCGCCGCCAAG
CTCTTCCACTTTGCCGCCGGCATGCGCTTCGCGCAGACGACAAAGCTGACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62