GenePrediction:GLEAN_7918 Details

Name: GLEAN_7918
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2235928..2234591 (- strand)
Length: 1338
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2235928..2235768 (- strand)
Length: 161
Type: CDS
Source: GLEAN
Position: GCSC_113:2235703..2235485 (- strand)
Length: 219
Type: CDS
Source: GLEAN
Position: GCSC_113:2235422..2234591 (- strand)
Length: 832
>GLEAN_7918 class=GenePrediction position=GCSC_113:2235928..2234591 (- strand)
ATGTACTCGCCGCCGGCAACATCGACGACGATGTTTGGCCCGCCGAGTACCGGAGCCCAGTCCCCCGTAACGGGCTTCGT
GCTGCAGCGTACGGTAGAGATGCCGATACTGCATGCCATCATGAAGGAGCAAGACTCTCGGAGAATATTCTACTTCATGT
GGTACGTCTGGCAGCTATGTGGACTTGGATTTGTGGGTGCCACAGCCTCTGACCTGTCCCTCTAGTCTCAACTTTTCCTT
TATGCTTGTCCAGGCATTCTACGGCTACGTCACCGACTCACTCGGCTTGTTGAGCGATAGTATACATATGTTCTTCGACT
GCGTGGCCCTCGGGGTGGGCCTGTTTGCAGCGGTGGCCAGCAAGTGGCAGCCAAACGAACGATTCCCGTACGGGTTCGGC
AAGATCGAAACGCTTAGCGGGTTTGCCAATGGCATATTTTTGATGTGAGTGCCAGAAGTGCAAGGTGTGCCTCATCATTG
CGCGCAGGTGCTAACGCGCACCACAGCCTTATCAGCGTCGAGATCATGGTCGAGGCGTTTGAGCGAATCCTCGGCGGTCG
GGAAACACAAAGGCTCATGGAGCTATTTATCGTCAGCACACTGGGCCTATTGGTGAATCTGGTCGGCATGTCCGCATTTG
GACATCACCACCACCACGGCGAAGGCCACGAGTGTCCGTCGCACAGCCAAACGCACGACCACAATCACGATCACGATCAC
GATCACGACCATGGCCATGGACATGACCATGAGCACAATCATGGCCACAATCATGGCCATGATCACAGCCACGGCCACGA
CCACGGCAACGAGAACATGTACGGCATCTACCTCCATGTTCTTGCGGACACGCTCGGCAGCGGTGCGGTGATCGTATCGA
CGGCGCTGACGCACTTTTGGGGGTGGGCTGGCTGGGATCCGCTGGCATCGTTTCTCATCGCAGTGCTCATCATGGGCTCG
GCAGTGCCTCTAGTCTCATCGTCGGCGCGGCGGCTGTTGCTGACAGTGCCGGCGGCGCTGGAGTACTCGCTGCAAGGGAT
ATTGGCGGATGTGGCTGGCCTGCCAGGGGTGTCGAGCTACGCGGCGCCACGATTCTGGGTTGACGACCGAGCCGGATCGC
AATCACGGCTGCTGGGCATGATGCACGTGGTGGCCAGCCGGGGCACCGACGTGAGCGATGTGCGCGATCGGGTGCGCAGC
TTTTTGCTGGACAAGGGTATCGACGTGGTGCTGCAGGTCGAGCGGGAGGACGACGGAATGTGTTGGTGCACCTCTGGGCG
CGCGCCGGGAGTGTCAGGGGTTCCGGGACACGGGGCCAAGCCGAGCCTCGCCTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62