GenePrediction:GLEAN_7919 Details

Name: GLEAN_7919
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2233604..2232495 (- strand)
Length: 1110
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2233604..2233292 (- strand)
Length: 313
Type: CDS
Source: GLEAN
Position: GCSC_113:2233162..2232495 (- strand)
Length: 668
>GLEAN_7919 class=GenePrediction position=GCSC_113:2233604..2232495 (- strand)
ATGGCACAGAAACCAGACGAAGCGCCATCGGCTGCCTTTGAACCGGTGCCAGAGCCGGTGCCGGCACCGGCTCTGGCGCC
GCCGTCGGCGCTCTCGGCACAGCTGCGCTCGTTAGCGGCCGGCGGCTTTGGTGGCATCTGTGCGGTGATTGTGGGCCACC
CGTTCGACCTGGTCAAGGTGCGGCTGCAGACGGCCGAGAAGGGCGTGTACTCGTCGGCGGTGGACGTGGTACGCAAGAGC
ATCGCGCGCGACGGGTTGCGGCGAGGGCTGTATGCGGGCGTGAGCGCGCCGTTGCTGGGGGTGACGCCAATGTGTGGGTG
TTTTTCTCTCTTTTCTCTTTTCTCTTTTCTCTTTTCTCTTTTCTCTTTTCTCTTTTCTCTTTTCTCTTTTCTTTTTCTTT
TTGTCTTTCCGTCTTTTTGTCTCCCTTCCCTAACATCTACAGTTGCCGTCTCGTTCTGGGGCTACGACGTCGGCAAGACG
CTCGTCCGGTCGATCTCGGCCGCCAACCCGGACGGCTCGCTCACGATCGGGCAGATCTCGGCGGCCGGCTTCTTCTCAGC
GATCCCGATGACGGTCATCACGGCACCGTTTGAGCGCGTCAAGGTGATCCTGCAGGTGCAGGGCCAGCAGCAGCTGGCGC
CGGGCGAGAAGCCCCGGTACAGCGGCTCGCTCGACGTGGTGCGCCACCTCTACCGCGACGGTGGGATTCGGTCGGTGTTC
CGCGGCAGCGCAGCGACGCTCGCGCGCGATGGCCCCGGCTCGGCAGCCTACTTTGCGGCGTACGAGTACATCAAGCACGC
GCTGACGCCCAAGGATCCGGCCACGGGTCAGCCGGCCAAGGACGGCAAGCTCAGCCTGACAGCCATCACAGTCGCCGGTG
GCGGCGCCGGCATCGCCATGTGGATCCCTGTCTTCCCCGTCGATACGGTCAAGAGCCGGCTGCAGACCAGCACTGAGCCC
GGCATCACCGTCGGCTCCGTCGTCCGCGACCTCGGTACGGCAAGGGCGGCATGCGCGCCTTTTTCCCCGGCATCGGTCCG
GCACTGGCCCGTGCTGTGCCGGCCAACGCGGCCACCTTCTTGGGCGTCGAGCTGGCCCATCAAGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62