GenePrediction:GLEAN_791 Details

Name: GLEAN_791
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2143260..2145205 (+ strand)
Length: 1946
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2143260..2143397 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_97:2143668..2144030 (+ strand)
Length: 363
Type: CDS
Source: GLEAN
Position: GCSC_97:2144135..2144558 (+ strand)
Length: 424
Type: CDS
Source: GLEAN
Position: GCSC_97:2144681..2144732 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_97:2144898..2144991 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_97:2145074..2145205 (+ strand)
Length: 132
>GLEAN_791 class=GenePrediction position=GCSC_97:2143260..2145205 (+ strand)
ATGGCAGACGCGTTTGCTCCCTTCAGGGTGGATGTTGACTTAGAAGCCGAGCGGGCGTTTGATACTCGACAGATCCACGC
AGGTGCAAAGCCTAACCCCGCCACAAAAGCAAGGGCTGTGCCTATTTACGCGACAGCAGTAAGGCGGCTTCATAAGTGTC
CATTTACGTGGGATTAGACCCGAAGGCTAATAGATCTGGTTGTGCAGTCATATGTCTTCACCGACAGCGAACATGCTCGG
CGTGTGTGTAGCAATGAGGAGGCGGGATACGTCTACTCCCGGATAGCAAATGTATGTCTATGGCCGAAGATTTCGCTAGC
CTCAAAACCCATATCATCATTACCCAAGTAAAGATGAATGGGACATGATTGTCACTTGCGGCTCTAACCACGCTTGGAAA
CCCGACAGCCTACAGTAGAAGTGTTTGAGAAGAGAGTCGCTGCTTTGGAAGGCGGAACCGCCGCGGTAGCATGTGCTTCT
GGCCAGTCGGCAGTCTTTCAAGCAATAATCTTGTGTCTAGCTCATACTGGGGATAACATCGTTGCATCAACCGCTCTCTA
CGGTGGTAGCTACAGCATGTTCAAGACGCTTCTACCTCGTATAGGGGTGACTGTTAAATGGGTGACTAGTGACAACGCTA
AGGATTACCGGCCGCTCATTGACGATCGGACGAAGCTAGTCTTTGTAGAGACAGTGGGCAACCCACGTATCAGTATCCCG
GATCTCCAGGCAATTGCCGATATCGCACATGAGTACTCGGTTCCCCTTATAGTATGTCCGCCCCGCCCCCTCCCTTAATA
TGGAAGGCACATGGATCTTTCGCTCTCGTATCCTCCCTTTCTTAGTTTTGTTTTCTCACGCCATGCATTGTATAGGTTGA
CAACACCTTTGGAGCAGGGGGGTTTTGGTGCCCCGTGATCTCTTTCGGTGCTGACATTGTCGTCCATTCTGCAACCAAGT
GGTTGGGCGGCCACGGCACAACCGTCGGAGGCGTCATTGTAGACTCGGGATGCTTCGATTGGAACAAAGCCGGGGATCGG
TTCCCGCATCTCACCCAGCTCAGCGATGGACCCATGCCATTTTCATATGCAGCTAATTTTGGCCGAGTGGCCTTTGCCAT
GGCCCTGCGGCTCGAAATTGTTATGGAGGTAGGGAGCGTGTTGAACCCCTTCGCTGCACAACAGATTCTCCTCGGCATGG
AAACCCTGAGCCTCCGTTGTGATCGGATAGCCTCCAACGCGTTGAAGATTGCCACATTTTTTTCCAAACACCCACAGACC
AATTGGATCAGTTATCCTGGTGAGTAAATATCCAAGCCCCGAGTTCGGGACCCCTCTTTTCTATGTATCATGGCTAGAGT
TGAAGTGCTGGGTGACAGCGAAGAACAAGACAGCTGACTCTTTTTCGCCACGACAACTTAGGATTGCCGACGGACAAGTA
CCATTATAGAGGAAAGAAGTATCTTCGTCGTGGGTACGGGGGTGTGTTGTCCTTTGGAGTGAAGGGTGGCACGATGGGCA
GTAAGGCGTTTGTTGATGCTCTCCGCCTTGTTTCAAATATGACAAAGTACGCGCATTCTCATGGTGGCAGCCTACAGTTA
CAGATTACATTACACTAACACGAGGTCGGGAACTATAGCGTCGGAGACTGCAAAACCATGGCGACACATCCTTGGAGCTC
GACGCACGCCATCATGACCGAGGAAGATCGGACAAATGCAGGGATCACCGAAGTGAGTATCTCTTAATACCATGCAACCT
CGCATGAGTACTTCATTTTTTAGAGATAACACTAAATCGATTGCGTGGTGATAGGATCTCATCCGTCTTTCTGTGGGAAC
AGAAGACGTAGAAGATATTATCAAGGACATTACCCGGGGGCTACAGGCTATTACACGCAGTGAGAAGATAACGAATGGAC
AAGGACACGCAGAGAGTGACAATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62