GenePrediction:GLEAN_7920 Details

Name: GLEAN_7920
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2227020..2224613 (- strand)
Length: 2408
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2227020..2226986 (- strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_113:2226935..2224695 (- strand)
Length: 2241
Type: CDS
Source: GLEAN
Position: GCSC_113:2224640..2224613 (- strand)
Length: 28
>GLEAN_7920 class=GenePrediction position=GCSC_113:2227020..2224613 (- strand)
ATGGGCCGCCCGCCTGCATACATATTCATCGTCAGGTCTGTCCATGTCGCCTGCTGCCCTTGTTACTGCTGTCTGACTAA
GCTAGGCATGGAAACCGACTCGATGCTGCCGACAAATTATGGCATCTCTCCTCGCCCACCCCATTCGACCCGCCCTTGAC
GTATGGAGGTTGGGCACAGTCGAGAACGATCGGCCAGCGCATCGGAAATATTCTGCGAGAGAACGACCCTGCTGAACCTC
GCTCTGTACCAAACAGCCCCGCCGTGGCCTCAGCCCCAAACAGCCCTGCCATTTCCGGCGACGCCCCTCCTCCAGCCAAG
AAACGCCGTTACAACGTCGTCATACACAGCTCGCCATTTCTGCGATGCATTCAGACGTCCATTGCCATTGCAGCAGGCCT
CGCCACTGATCCACGGCCTCTGGAGTCCTCCCCAAGCAGCCCAGAGCCTCTATCACCCCTACCACAGCAGCTTGCGGTCC
AAAATACTACCGCAGTGTCGTCCGATATCACCCACCCGAAAGAGACGACCCCCAAAATAAAGAAGACCCTCATGCGCCTT
GATGCCTTCCTGGGCGAGTGGCTGTCGCCTGGATACTTTGAGCTCATTACCCCACCGCCCAGCTCGCACTTGATGGTGGC
CAGAGCAAAGGCCGACCTTCTACGCCGAGAAGACTACTCAAGCTTCAAATACACTCCTGGACACACGTACTCCCATTCCA
CCAGCCAGCTATGGGGTGGAGGTGCGCCTCTCAGCCTTTGGGCATCTCGCCTGGATGAGAACGAAGACGCGTCGACGTTC
AGCCCACGGCCAGTATCCCCGACAATTCAAAACCTCGCAGCTGACAGCTTGTCCTTGCCTAAGAATGGAGGCCCTCCGAG
TCCGCGCTGGTCGGGCGGCCGTGGGGGGGCTGGAAATGGCACGCGTCCTAATCCCGGTGGCTACGTGGCACCAGTCCCCC
AGTTTGCCCTGTCTTCCAAAACACAGGCACCAGTTGACTACGTTGCACACGCCCGAGATGCCTGCGTGGAGTTAGACTAC
CAGTGGGACTCGATGCGAGCGCCGCTCGACTGGGGCGACGGCGGCGAGTTTGGAGAGGAATGGCCTGCGATGCACCGCCG
GTTCCGCAAGGGCCTGCAGCATCTGGTGGATTGGTACACGACCAGCGACGATCCTACGGAGCCCGTGACGAAGCTGGTCC
ATTTCAAAGCACCCTCTTCGCCGACTGGCGGACAATCGATGGATTGCGCAATTGAGGACGACAGCATGACGGTCGACAGT
GATGACGATGACTACATCGAGGAGTCCGTCGTCATCCTCGTGTCCCATGGAGCCGGGTGCAACGCGCTGATTGGGGCTAT
CACTCAGCACCCGGTTCTGATGGATGTGGGCCTGTCGTCGCTGACAGCAGCTGCGCGAAAACCGGGCATGGACACAGCAC
CGACACAAGTAAGCCGCTCAGCTGGCAAGGCCGGCAGCAGAGGCGGATCGGCCATGGGCACAGACCTCCTGCACAATGCC
AACGGCGTCGTTCCCCTCAACCAGTACTACGATATGAAGCTTTTTGCTAGCACTGAGCACCTGCGGTCGTCAAACTCATC
GCCATCTGTGTCTCGATCGGGCAGCATCGCCGGCGTCTTGGGTGGCACGCGTGCCCGCCACTCAAACTCGCTCTCATCTG
CCCTTTCTGGCGTCGGCTTTGGGGAGAACAGCTTCGCCGCCCATAGGAGCATTTCGGCAGGCTCGTCTTACGGGACCGGA
CGGCGGCCGTCGGGCACCGCGACTCGCCCGACGTGGATGTCCACCATCACCACCACACCTCGCAGCAGCGGCAGCTGTGG
TGGAATCACTGTCGGCAGCGGAGCTACGAGCTTTTCGTCACCAGTCACCTCCAGTCCCTTAAGTCGCGCTACTAGGCCGT
CAATTGGTCTGTGGTCACCCGCAAGCGTGAAAAGCTATGACAACGATGGGGCCATGGACGAGGATATGGAGATCCTACTC
AGCTTTGGCCCGGAAAGTGTTTCGGAGCAGCAGGGGGGAGTCAAGGAGGAGAAAAAGGAGCAACAAAAGCTGTCAGTGCC
TGCCACAGTTGCAAATGGCCAGACTGAGAAATGTGCCGCCTCCTTGTCCACGGCTGTCACGACACAGAACGGAGGGAACA
TTAAGAACGGTGCGTCGAATGGCAAACAGCTGGAGGCCTCAGCCTCATCCATGGCAGACTTTTCTTCACTAGGCCCAGCT
GCCATTGGGGGGCTATGGTCAACGCAGCCAAAATCGGCTGTAGATCTAGAACCAGTGCACGGCATGGCGTCGACGAAACG
GCGATGGTCAGTGAATGATCGAGCATGACAACAATGTTTTTGTTGTGACCTTGTGAACAGGGCGGGATCTCAGCTTTCTC
TTTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62