GenePrediction:GLEAN_7921 Details

Name: GLEAN_7921
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2217843..2215877 (- strand)
Length: 1967
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2217843..2217779 (- strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_113:2217696..2217018 (- strand)
Length: 679
Type: CDS
Source: GLEAN
Position: GCSC_113:2216950..2215877 (- strand)
Length: 1074
>GLEAN_7921 class=GenePrediction position=GCSC_113:2217843..2215877 (- strand)
ATGGCGTCACCACAGCAAGAAGAGAAGGAGTTCAAGCACCCCGAGGCGTCTCATGCCCGGAAGAAGTGAGCCGCATTCCT
GTTCTTGCTTTTCTTTCCACTGTCTTTTGTGTGTGCCCACTTTCTGACGCTTTCCATCATTCGATAGAAACAAGAATCCC
AACAGTATAGAGCCAATCACCGTTTTTTACATGTTCATAGCCGCAAACCTGTTCTCAGCTGTTTATGCACCGATCCAGGA
CTGTGATGAGACCTTCAACTACTGGGAGCCCACCCACTACCTCGTTCATGGGTACGGCCTGCAGACCTGGGAGTACTCGC
CGGACTATGCGATCCGCAGCTGGCTATACGCCGGCCTGCATGCCGTGGTGGCCGGTCTCCGCCGCATTTTGCCGCAGACG
TCCAAGGTCGGCGAATTCTATTTCGTCCGCTATGTCTTGGCCTTTGTCTGCACCATCTGTCAGACCTTGCTCTTCCGGGT
AATCAGTGGCACGATTAACCCGCGCATCGGCTTCTTCTTCGTGGTCGCGCTGTGCACCAGCCCGGGCAACTTTCACGCCA
GCACTGCCTTCCTCCCGTCTAGCTTCGCCATGTATGCCGTCATGTTAGGCGCAGCCTCCTTCATGGACTGGCGCGGCGGA
CTCAAGACGCTCGGGGGCATGTTTTGGTTCGCGGTAGCCGGCGTGATCGGCTGGCCGTTTGCGTCTGCCCTGTGTGCCCC
CTTTATTGTTGAGGAGGCTTTTCTCGCCCTCTTCGGTGGTGGGGAGGCACTCTATGAGAGCTTCATCCGGGTTGCGCAAG
GTGTCGTCGCAATATTTCTACTAGTGGTACGTTCATCGTTACATCATACATGTGTTGCTCGACTGTCTGCTTAGTGCTGA
CCCTGTCTCCTAGGTTTCTGATACCATTGTCAACACATTCTTTTACAAGAAGGTCGAGGCCGTCGCATGGAACATTGTCG
AGTACAATATATTCTCCTCCAGCGGTGGGCCGAACCTCTATGGCACCGAGCCTTGGACGTTTTACTTCAAGAACCTCGCC
TTGAACTTCAACATCTGGTTCATTCTCGCTCTGCTGGCGTTTCCCCTGTTCCTTCTTCAAAAGGCAGCAGGGTCATCTGG
AGGGTCGCTGCGCGCCTTAGTTTTCCTATCGCCCTTTTACATGTGGTTGACCATCTTTACGTTCCAGCCTCACAAGGAAG
AGCGATTCATGTACCCGGCCTACCCCTTCTTAGCGCTGAACTCAGCAATCTCCTTGCATATACTCCTCGAAATCCTCGGG
AGCAGAGGCCCCGGAAATCTGATGGGCATGATCCCAGCAAAGCTCAAACTCTTCTCGGTCGTGGGCGTCTTCTCGACGTT
TCTGGCCGTGAGCATTCTTCGCATCTGCGGCGTGATATCGGGCTATGCAGCACCGCTGTCCCTTTATGACCCTCTTGGTG
CACAGCTTGCGCACATCAACTCAGAGCAAGGCATAGGTGGTCGTGGCGACTTTGTGTGCTTCGGAAAAGAGTGGTACCGG
TTTCCAAACTCGTTCTTTCTGCCGCGGGACATGCATGCCAAGTTCATCCGGTCTGAGTTCCGTGGTCTGCTGCCCGGCGA
GTTTTCCGAAGCCCGGACTGGATTTGGCTTGTGGAGCGGCACGTGGCTGCCAACTATGGGGATGAACGACATGAACGAGG
AAGACATGGGGAAGTACACGGACATCCGTACGTGTGCCTTTCTTGTGGACACGCAGTACCCCGAAAATGCCCGCAAGGGA
CTTTCTCTGCCGCCGAACGAGCCCGACTACGTGGCCGACACGGAGAACTGGGATGTGGTGAAGTGCCTACCTTTTCTTGA
CGCTGGCAACACTGGATTTCTGGCTCGAGCGCTGTGGATACCAAGTTTTGACTTTTTGCCTCCGCAGCTGCAGCGCAAAT
GGGCACGGCACTGCCTCTTGCGGCGGAAGAATAAAATTGGCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62