GenePrediction:GLEAN_7922 Details

Name: GLEAN_7922
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2211963..2210609 (- strand)
Length: 1355
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2211963..2211813 (- strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_113:2211447..2211344 (- strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_113:2211087..2210934 (- strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_113:2210871..2210609 (- strand)
Length: 263
>GLEAN_7922 class=GenePrediction position=GCSC_113:2211963..2210609 (- strand)
ATGCCTGTCTTCTATCTTGTCCAGGGTTCCGATTCTGACACTGAACACTACGAGTACGGAGTTTACGCCCCACGTGTACG
GAGGTTGGAATATGGCGTGACACGCGCCCAGAAGGGCGATCCTGGCTACACCCGTTACAAGAATGGAGTCGGTATGCAGT
TATACGTACTCATAAAGGCTCTACGATGCAGTGACCAGGGCTATTGCTGTGGCAATATGACCTGTGGACACGCTCTTTAC
GCATAGGTGCACACGCCCGAGCTCCCACAAATGGGAGGTCTGGAGCGGCAAGAGTGGCTCTTTGTCTTTAAGAGGGGGGC
GCCTTCCGTTTCATGCAGCTGGGCTTTAGTACTCGCTCTCTCCTCTCTCCATAAACATTCACAGCTTCAAATACCCAATT
TCTCGCTTCTCGCTCTCGATTTCGAGTCAACCTCAGCGCAGGCACCACATTGCCCCTCCACACATCTCCTTGTTGTAAAA
CGTGCTAAAATGGTGAGTACAAGTGACACAATGCAGACACGGCTGCTATGCAGCAGCCATCCCTGGGACCGGCCTTGGCT
GGCAGCGGTTGCCGGCGTAAACAAAGCAAGGAGGACGGCAGCATCTTAGTGGCGCTGAGGGTTTAGTTAGTGCGCGTCCG
CAGCAAACATCGCCCGCGGCCGGCGTGATGGCAAAAAAAACAAAAGGCCCAGACATTTCGCGACCATCTCTGCAGCCGCA
CCATTTCCGCCATTTGCTCTGAATTTTGCAGTTTTCATCTTCCATCTTTCATTTTCCATCCTCCATTGCCGGCCCTCCTT
CGCACCGCTGCTCCTCTCCTCTCTCTGTCATCGAAAAGCCCCGTTCGTCATGGCTTCTAACCAGTTTGAACCGCAGGCGT
CCACCAACTACAAAGAGGCCTTCTCTTTGTTCGACAAGCGCGGCAACGGCCGGGTGACGCTCGATAGCCTCGGTGATCTC
CTGCGCGCCTGTGGCCAGAACCCGACGCTCAGCGAGATTCGCGATCTCGAGAAGAACGTGGGCGGAGACTGTAAGCGCAT
GACCCTTCCCCTTCGCCTGCCGATCTGGCTGCTGACAAGCATATGTGCGCAGTCGACTTTGAGACGTTTCAGCGTATCCT
CAACCGGCCGGGTGGCTTCCGCGACCCGGGCGAGCCTGATGAGTACTGCCGCGGCTTCCAGGTGTTCGACAAGGACATGA
CCGGCTACATTGGCGTCGGCCAGCTCAAGTACATCCTGACGAACTTGGGCGAGAAGATGACGGACGAGGAGGTGGACGAG
CTGCTGAAGGCAGTCGACACGAGCACCGGCCAGGTCAACTACACAGATCTCGTGCGGACAATTCTTGCCAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62