GenePrediction:GLEAN_7923 Details

Name: GLEAN_7923
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2209888..2207661 (- strand)
Length: 2228
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2209888..2208000 (- strand)
Length: 1889
Type: CDS
Source: GLEAN
Position: GCSC_113:2207931..2207661 (- strand)
Length: 271
>GLEAN_7923 class=GenePrediction position=GCSC_113:2209888..2207661 (- strand)
ATGGCCGACAAGTACAAAAATCCGCCCCAGGCGCCGCCCACCTTCACGGGCACCAAGGAGAGCATCCTGGCCGATGCCAA
GGCGCTATGTGAGAAGACACGAGGCATGCTAGACCAGGTGGTGGCCGACGTGCCTCTGACGGATACGAGCAAGGCGACGT
TTGTGACGGTGATGCAGCCGCAGGTGGAGGACGAAAACGAGGCGTCGCTGTCGGCGCACATTCTCGGCTTCTACAAGTAT
GTGTCAGCAGACGGTGAACTGCGTGACGCGAGCACGGAGGCGACGAAGCTCATGGACGATTTTGGCATCGAGGCGGCGAT
GCGCGAAGACGCTTTCCGGGTGGTGGATGCGGTGGTACGCGAGTATGGCGGGCGTTCAGCATTGGAGGCGATCGAGACGG
CGGGGACGACGGACAGCAAGACGGGGCTCGATGCGGAGAGTGCGCGACTGCTGGTCCGGGAGCACAAGGGGTACATCAAG
AACGGGCTGGACCTGAAGGGCCAAGAGCGCGAGCGGTTTAAGGAGATCCAGAAGCGGCTCAGCCAGATCCAGATTGTGTT
CCAGAAAAATTTGAACGAGGAGAGCGGTGGGATTTGGTTCACGCGCGAGGAGCTGGACGGGGTCCCGGCCGACGTCGTGG
ACGGGCTCGAGAAGGGGGCAGAGGGCACGGAGCAGGCAGGCAAAGTGAAGCTGTCGTTCAAGTACCCGGACCTGTTCCCG
ACGCTCAAGTTTGCCAAGCTGCCAGAGACGCGGCGGAAGGTGTTTTTGCTGAACGAAAACAAGTGCAACGAAAACGTGGC
GCTGTTCCACGAAGCATTGGTGCTGCGCGACGAGAAGGCGCGGCTGCTGGGCTACGACAACCACGCAGCGTTGCGGCTAG
AGGACAAGATGGCCAAGACAGTGCCGGCGGTGAACGAGTTTCTGGAAGACCTGCGGCAGCGACTGGCCCCTGGTGGTGCC
AAGGAGGCGCAGCACTTGCTGGCCCTGAAGGAGGCGGACACAAAGGAGCTGGGGCTGCCGTTTGACGGCAACTACTACCT
CTGGGACCACCGGTACTACGACCGGATGATGGTGGAGAAGGAGTACAGCATTGACGAAAACAAGATTGCCGAGTACTTCC
CGCTGCAGAAGGCGGTGGTAGCGATGCTCAAGATCTTTGAGCAGCTGTTCGGCTTCGTCTTTGTCGAGCTGGGCGAAGAG
GACCGGGCGCGCATCAGTCCGACCGGACGGGCCGAGGACATTGTCTGGCACGAGGACGTGATCGTGTTCAGCGTGTGGGA
CGACGTGGCTGGCAGCGACGGCTTTGTCGGCTACCTCTACCTGGACCTGCACCCGCGGCCGGGCAAATACGGCCACGCAG
CCAACTTCAATCTGCAGCCGGGATTCGTGCTGGCCGACGGCAAGCGGCGGTACCCGGCTACGGCGCTGGTGTGCAACTTT
AGCAAGCCGACGGCGACGAAGCCGTCGCTTCTGAAGCACGACGAGGTCGTCACGCTCTTCCATGAGCTCGGCCACGGCAT
CCATGATCTCTCAGGGCGGACGCGCTTTGCCCGCTTCCACGGCACGGCCACGGTGCGCGACTTTGTCGAGGCGCCCAGCC
AGATGCTCGAGAACTGGTGCTGGACGCCAGCGCAGATCCGTGCCCTCAGCAGCCACTACGAGACCAACGAGAGTATCCCC
GAGGACCTGGTCGCCCGCCTGGTCTCCACCAAGCACGTCAACGACGCGCTCTTCAACTTGCGCCAGCTGCACTTTGGCAC
CTTTGACATGGCCGTGCACACGCCCAAGACGCACGCCGAGATCGAGGCGCTCGACGTCAGCAGCCTCTACAACGATTTGC
GGGCACAGCTGTGTCTGCTCAAGGGTCCAGAGTCTCAGGGAGAATCTAGGTTGGCCTTCTCTTTCCTTTTTCCGTTTTCC
TTTTCCCCTCTCCCTCCTATCCTTGCTGACCTCTCAGCAACTGGGGTAATGGCCAGGCCTGCTTCGGCCACTTAATCGGT
GGCTACGACGCCGGCTACTACGGCTACCTCTTCTCGCAGGTCTACTCGACCGACATGTTTGTGTCCGTGTTCAAGGCCGA
TCCCATGGACGGCGTGCAGGGCCGGCGCTACCGCCATACCGTGCTGGAGCGCGGTGGGTCGCAGGACGAGATGCGCACGC
TCGAGCAGTTTCTGGGCCGCAAGCCCAGCGGCGACGCCTTTTACGAAGAGCTGGGCATCCCAGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62