GenePrediction:GLEAN_7924 Details

Name: GLEAN_7924
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2195595..2193282 (- strand)
Length: 2314
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2195595..2194919 (- strand)
Length: 677
Type: CDS
Source: GLEAN
Position: GCSC_113:2194851..2194606 (- strand)
Length: 246
Type: CDS
Source: GLEAN
Position: GCSC_113:2194547..2193448 (- strand)
Length: 1100
Type: CDS
Source: GLEAN
Position: GCSC_113:2193388..2193282 (- strand)
Length: 107
>GLEAN_7924 class=GenePrediction position=GCSC_113:2195595..2193282 (- strand)
ATGACGGCATCAGAAGAGAGCAGCTCTGAATTGAGCCCGGCTCAGCTGAACGCCCTCTTCGACATCTTGACTCACCATCA
GACATATCAGGAGATACAGAGCTTCAAACAACCGGAGACAATTTACTCATATGGATTCCCTTTTGCGCAGAGGCTGGCCA
GCAATGAGGACGGAAGTGATGTCGCAGGCGACCAGACAAAATGTCCCATCTATGCCGACAAGTCGGACACTCCCACACTG
CAAATGATGCTGACTAAAACTGTTCTTTCTCTGCCGCCGGCAAAGGCGCTGCCGGACGATTTCTGGCATGTACGCATCCA
GGAACTCATGGCCTTGCTGGGAAAAGCGGAGCTTTCTGAAAGCTACGACCAGGGCGCAATGGGCACGCGCAAGATCCTGG
CAACGGCCTCGTCGTCTCTGCTCGAGTCAGTCAGTCGTGGTATGTTAGGCGGATATCCGAGCGGGGGAGGCGACTCGTCA
GCTGCACATACCATTGTGCCGGATCGGACCTACGACACGACGAACGCTGTGGAGTTTTCCCAGGCCTGGGATGATGTTGT
GCGTGCCATGATTTACGGCACCCTCCTAGACGATCTATTTCTGTTCTGCGCTGAGCATGAAGACATTGAGCAGCACTCAT
CTGCCGTTCGCACGGCTGTGGACTACATCATCATTCAGTCAGTCCTCACTGCAGTTACGAATGTAGAAAATTACGCGCTG
ATTTCGACTGACGGCATTTTCTAGACTTGCTGAGTTCTTGCATTATGTCTTTGTGCTCTCACCAAATGGCCGGTACTTGG
TGAAGCTAGCGGAGAATACGCAGAGGATGGTTCCATATGCCCTCATACGGCAGACTCTGCGTGTTGGTAACGCAGCTACC
ATGATCAATGCTATGATGAAGCTGCTTTTAGCTAAGATAAGCGTGGGAGGCCTTACGAACTGGATGGGCTTGACATCATC
CGCTGGCGAGGGAATGAATCTGCTACAACGGTGAGCCATGAGCTGCATTATTTCTCAGCGTATAAGACAGCATGGCTAAC
AGTGGTAGTATAATCGCCATGGTGTTGTCATATGACTCGTCAGACTTTAGGAAGGCAGCAGAAAAGATCGAAAGGGACAA
GGATGGTCCTGGCGCGGCACACCTAGAAGCTATCAGGGAGCACCTCGCAAGGCCGCAGCAGTACCATGAGGCAATTCGAA
ACAAGAGCGTGGAACAGAGCCAGTCGATTGTCATTGCGATACTGGAGTCCGTTGATCCGTCCCTGGTCGGCTCTATCAAC
GACAAGCAACATGCCCAATGTGCCCAATACTACGCATCGTTGCTTTCCATTCGAGACCGCAACCAAATCACCGAGGTTTT
TTGTCACCAGAGCCCAGACCTGTTCACTCAGGTTCTGCGGGACGGCATTTCAGCTTGCGATCCCATTCTGCGACGGATTC
ATGACAAAATCGACCTCAAGGAACACCTCGGGGATCTTGAGGGATTTTTGGACGAGTTGATTGAAGTTTGCAAGGGCCAG
AAGAAGGCAGTCACGCCCTTTAGATTTGCCAGTGACACCGTCGGAAACGGGGCCTCACTTCCGACGGTGAAAGACTACAC
CGATCTTCTGAGGCGGAACCGCCACCTTCTCTACAAATGGCTTCATCGAGTCGCCAAGGACACGCCTGACATACGGGAAA
CATTTCGGGACTGGGCTGTCAGCGCAGTGACAGTATTTCGAAACCCCAACGTGACAGTCAACGCCAGCAGGCAGGAAACA
AGTGAGCAGCACAAGAACAAGCCGGAGTCAAGCCGAAGGCCGTGGCCGGATGGCGGTTCGGGTGCCATGAATGGCAGTCT
GCAGGGCCTCTTCTCGGCTTTACCGGCCGAGACACAGGCATCAATCGCGCCTCTGATCGACGCTCATGCGGCCTACATCG
ACGCACTGGACGAAATCGCAATCAAGCGAAGGCAGCGCCTGATTGATATGATCAACGGTAACGGGAGCAACGAAGACAAG
AATTCCATTGAAGGAGACGGAAAGGCAGCCAGCCCAAGCCGGTTTCTCGCACGTTGGCAGGCCCTCCTGGACGATACGCT
CATTGGCCCGGCGACACCTACGGGCCCGGTTCGCCGTGGACGAGACGTTGCCAACATCACGGCACCAGGTAAGATGGAGG
TTAGCGGGAGCGCTTCAAGACGGACGAGTGCAAGGAACAGCCGGCAGCCATCACCGGCTCGACCTGGGTTGGCAAGGGCG
GAAACAGCCAAGGTCTGGAGTCTGAAGCGACCAGACGTGAAGCTGGTGTTCGAGACTTTGGGGCCGCAGTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62